ID: 1028460394

View in Genome Browser
Species Human (GRCh38)
Location 7:91085569-91085591
Sequence GTTAACAGGTGGACATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 452}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028460385_1028460394 17 Left 1028460385 7:91085529-91085551 CCTTTTGCTGTGAAAAGTTACCT 0: 1
1: 0
2: 1
3: 20
4: 301
Right 1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG 0: 1
1: 0
2: 7
3: 57
4: 452
1028460384_1028460394 18 Left 1028460384 7:91085528-91085550 CCCTTTTGCTGTGAAAAGTTACC 0: 1
1: 0
2: 3
3: 22
4: 223
Right 1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG 0: 1
1: 0
2: 7
3: 57
4: 452
1028460389_1028460394 -3 Left 1028460389 7:91085549-91085571 CCTGTTCACCAGCTTCAGGGGTT 0: 1
1: 0
2: 1
3: 16
4: 124
Right 1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG 0: 1
1: 0
2: 7
3: 57
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028460394 Original CRISPR GTTAACAGGTGGACATCTTT GGG Intronic
901130204 1:6957788-6957810 ATTATGACGTGGACATCTTTAGG + Intronic
901377558 1:8850183-8850205 ATTAACAGGTGCAAATCTTTTGG + Intergenic
901752014 1:11416117-11416139 AATAAGATGTGGACATCTTTTGG + Intergenic
903041156 1:20531741-20531763 ATTGAGAAGTGGACATCTTTGGG - Intergenic
903376927 1:22872471-22872493 ATTAAGACGTGAACATCTTTGGG + Intronic
904172419 1:28600663-28600685 CTTAACTGTTGGACATTTTTAGG - Intronic
904312505 1:29638083-29638105 ATTAGCATGTGGATATCTTTGGG + Intergenic
904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG + Intergenic
908037942 1:60075838-60075860 ATTAAAAGGTGGACATCTTGAGG - Intergenic
908067315 1:60420994-60421016 ATTAGAATGTGGACATCTTTGGG - Intergenic
909363749 1:74796116-74796138 ATTAGGACGTGGACATCTTTGGG - Intergenic
909995493 1:82274074-82274096 ATCAACAGCTGTACATCTTTTGG - Intergenic
910726327 1:90343635-90343657 GTTACCAGGTGGAGATTGTTAGG - Intergenic
912154157 1:106896793-106896815 GTTAAAATGTGTACTTCTTTAGG - Intergenic
912234012 1:107828837-107828859 GTTAAGATATGGACATCTTAGGG + Intronic
912819748 1:112857326-112857348 ATTAAAACATGGACATCTTTGGG - Intergenic
912999347 1:114564114-114564136 ATTAAGATCTGGACATCTTTAGG + Intergenic
913387666 1:118277480-118277502 ATTAAGATGTGGACATCTTTAGG + Intergenic
913390637 1:118307716-118307738 ATTAGAATGTGGACATCTTTAGG - Intergenic
913968443 1:143395661-143395683 GTTAGGACGTGGACATCTTTGGG - Intergenic
914062821 1:144221257-144221279 GTTAGGACGTGGACATCTTTGGG - Intergenic
914116329 1:144745097-144745119 GTTAGGACGTGGACATCTTTGGG + Intergenic
914349543 1:146828376-146828398 ATTAGGATGTGGACATCTTTCGG + Intergenic
916034808 1:160912395-160912417 ATTAGAATGTGGACATCTTTGGG + Intergenic
916475097 1:165161785-165161807 GATAGGATGTGGACATCTTTTGG - Intergenic
916970938 1:170015090-170015112 GTTAACAAGTGGAAAATTTTGGG - Intronic
916986176 1:170193343-170193365 GTAAACATGTGGACTTATTTGGG + Intergenic
917134713 1:171778474-171778496 ATTAGGAGGTAGACATCTTTAGG + Intergenic
917141343 1:171839012-171839034 ATTAAAATGTGGACATCTTTGGG + Intergenic
917742347 1:177972926-177972948 GTTTGCAGATGGCCATCTTTTGG - Intronic
918555419 1:185793559-185793581 GTTAGGATGTGGACATCTTTGGG + Intronic
921151548 1:212407012-212407034 ATTAACACTTGGACATCTTTGGG - Intronic
921341624 1:214139970-214139992 GTTAACAGTTGGACCTCCCTTGG + Intergenic
923769606 1:236926974-236926996 GTTAACCATTGGACATCTCTGGG + Intergenic
924781267 1:247150063-247150085 GTTAACAGGTGGGGGCCTTTAGG - Intronic
1064504467 10:16013962-16013984 ATTAGAAGGTGGACATCTTTTGG + Intergenic
1064618254 10:17186237-17186259 ATTAAGATGTGGATATCTTTGGG - Intronic
1065416017 10:25487097-25487119 ATTAAGAGGTGGATATCTGTGGG + Intronic
1065694992 10:28371497-28371519 ATTAGGATGTGGACATCTTTCGG + Intergenic
1065859597 10:29860811-29860833 ATTAGGACGTGGACATCTTTGGG - Intergenic
1066374977 10:34849691-34849713 GTTTGCAGGAAGACATCTTTGGG + Intergenic
1066589127 10:36973885-36973907 ATTAGAATGTGGACATCTTTTGG - Intergenic
1068581527 10:58745851-58745873 GTTAGGATGTGGAGATCTTTGGG + Intronic
1068680155 10:59810763-59810785 ATTAGCATGTGGACATCTTTAGG - Intronic
1069510217 10:69036537-69036559 ATTAAGACATGGACATCTTTGGG + Intergenic
1069802685 10:71091879-71091901 ATTAGGATGTGGACATCTTTTGG - Intergenic
1071528907 10:86374385-86374407 ATTAGCATGTGGACATCTGTTGG - Intergenic
1074471041 10:113726921-113726943 GTTAGGGCGTGGACATCTTTGGG + Intronic
1074548945 10:114425515-114425537 GGTTCCAGGTAGACATCTTTTGG + Intergenic
1075005129 10:118824691-118824713 GTTGGCAGGTGGAGATCATTAGG - Intergenic
1078451505 11:11443995-11444017 ATTAGGATGTGGACATCTTTGGG + Intronic
1079022132 11:16917745-16917767 ATTAGCACATGGACATCTTTTGG + Intronic
1079254124 11:18811851-18811873 GCCAACAGGTGAACATCTCTGGG + Intergenic
1079598488 11:22283810-22283832 GTTAACAGGTGTGGATCTTCAGG - Intergenic
1079684507 11:23340920-23340942 GTTAGGAAGTGGATATCTTTGGG - Intergenic
1079986549 11:27206222-27206244 GTTAGAACATGGACATCTTTGGG - Intergenic
1080269321 11:30434197-30434219 ATTAGGATGTGGACATCTTTAGG + Intronic
1080442102 11:32304224-32304246 GTTATCCAGTGGACATTTTTGGG - Intergenic
1080994072 11:37579428-37579450 GTTAACAGGTAGACACATGTAGG + Intergenic
1082993172 11:59226433-59226455 GTTAGAATGTAGACATCTTTGGG + Intergenic
1085985843 11:81786870-81786892 ATTAGGATGTGGACATCTTTAGG + Intergenic
1087029120 11:93684621-93684643 GTTGTCAGGTGGAGATCGTTAGG + Intronic
1087110336 11:94459873-94459895 TTTAAGACGTGGACATCTTTAGG - Intronic
1087332950 11:96805813-96805835 ATTAGAATGTGGACATCTTTGGG + Intergenic
1088035674 11:105311124-105311146 GTTAACATGTGAAAATATTTTGG - Intergenic
1088326527 11:108606473-108606495 GTTACTAGGTGGAAAACTTTTGG - Intergenic
1088340390 11:108758871-108758893 ATTAGCATGTGGACATTTTTTGG + Intronic
1088572543 11:111237050-111237072 GTTAGGATTTGGACATCTTTGGG + Intergenic
1090467850 11:126951108-126951130 GTTAGGATGTGGATATCTTTTGG + Intronic
1091868802 12:3869257-3869279 ATTAATATGTGGATATCTTTAGG + Intronic
1092581107 12:9842981-9843003 ATTAGAATGTGGACATCTTTGGG - Intronic
1093518507 12:20019914-20019936 ATTAGAATGTGGACATCTTTAGG + Intergenic
1096055826 12:48651124-48651146 ATTAGGATGTGGACATCTTTGGG + Intergenic
1096883236 12:54689958-54689980 ATTAGGATGTGGACATCTTTTGG - Intergenic
1097354120 12:58582564-58582586 ATTAAGATGTGAACATCTTTAGG - Intronic
1098445948 12:70565753-70565775 GTTAGGACATGGACATCTTTGGG - Intronic
1098832472 12:75378497-75378519 GCTAACAAGTGGAAATTTTTAGG + Intronic
1098958642 12:76714756-76714778 ATTAAGATGTAGACATCTTTAGG + Intergenic
1098976480 12:76907601-76907623 ATTAGGATGTGGACATCTTTGGG - Intergenic
1099084011 12:78222331-78222353 GTTAAGAAGTGGACATTTATTGG - Intergenic
1099863477 12:88248861-88248883 ATTAGTATGTGGACATCTTTTGG - Intergenic
1100777856 12:97991929-97991951 ATTAAGACATGGACATCTTTGGG + Intergenic
1100801433 12:98235436-98235458 GTTTACAGATGGCCATCTTCTGG + Intergenic
1101841611 12:108331547-108331569 ATTAGGATGTGGACATCTTTGGG - Intronic
1102418744 12:112787257-112787279 ATGAAAATGTGGACATCTTTTGG + Intronic
1103166086 12:118771918-118771940 TTTGACATGGGGACATCTTTTGG - Intergenic
1103833022 12:123795711-123795733 ATTAGGACGTGGACATCTTTGGG + Intronic
1104111633 12:125710152-125710174 ATTAGGATGTGGACATCTTTTGG - Intergenic
1104289090 12:127452134-127452156 ATTAGAATGTGGACATCTTTGGG + Intergenic
1104299607 12:127552334-127552356 ACTAACATGTGGACATATTTAGG + Intergenic
1105731824 13:23225169-23225191 GTTAGGATGTGGACATCCTTGGG - Intronic
1105769881 13:23599238-23599260 TTTAACAGGTTGACATATCTAGG + Intronic
1106473346 13:30077195-30077217 GTTAGGATGGGGACATCTTTGGG + Intergenic
1107173746 13:37376419-37376441 GTTAGCACGTGGGTATCTTTGGG - Intergenic
1107691814 13:42961004-42961026 GATAAAACGTGGACATCTTGGGG + Intronic
1108047384 13:46396074-46396096 ATTAAAATGTGGACATCTTTGGG - Intronic
1108069199 13:46610191-46610213 GTTCAAAGGGAGACATCTTTTGG - Intronic
1108391326 13:49950805-49950827 TTTAAGATGTGGAGATCTTTGGG - Intergenic
1109203168 13:59453280-59453302 AGTAACTGGTGGTCATCTTTTGG - Intergenic
1109815431 13:67576022-67576044 ATTAAGATGTGGACATCTTTGGG + Intergenic
1110441962 13:75536389-75536411 ATTAGCATGTGGACATATTTGGG - Intronic
1112257844 13:97851064-97851086 ATTAGGATGTGGACATCTTTGGG - Intergenic
1112647304 13:101349366-101349388 GTTAGAATGGGGACATCTTTAGG - Intronic
1112819453 13:103314331-103314353 TTTAACTGGTGGTCATCTTTGGG - Intergenic
1114446068 14:22789253-22789275 ATTAGGGGGTGGACATCTTTGGG - Intronic
1116089421 14:40285901-40285923 GTTAAGAGGTGTTCAACTTTGGG + Intergenic
1117662557 14:58022421-58022443 ATTAAGAGGTAGACATCTTTTGG + Intronic
1118150405 14:63182972-63182994 ATTAGCATGTGGCCATCTTTGGG + Intergenic
1118377896 14:65192720-65192742 ATTAAGATGTGGACATCTTGGGG - Intergenic
1118728404 14:68649034-68649056 ATGAAGAGGTGGAGATCTTTTGG + Intronic
1120125398 14:80736043-80736065 GTTAGGTTGTGGACATCTTTTGG + Intronic
1120414301 14:84199970-84199992 ATTAAGAGGTAGATATCTTTGGG + Intergenic
1120836498 14:89042509-89042531 ATTAGGATGTGGACATCTTTGGG - Intergenic
1121077571 14:91082081-91082103 ATTAGGATGTGGACATCTTTTGG + Intronic
1122448691 14:101785712-101785734 ATTAGGATGTGGACATCTTTAGG + Intronic
1126277793 15:46904423-46904445 ATTAAGATATGGACATCTTTGGG + Intergenic
1126309775 15:47302451-47302473 ATTAAGATGTGGACATATTTTGG - Intronic
1126365156 15:47886562-47886584 GTTAACAGGTGTAGACCTTCAGG - Intergenic
1126869168 15:52969337-52969359 ATTAGGATGTGGACATCTTTAGG - Intergenic
1127989942 15:64106506-64106528 ATTAAGATGTGGACTTCTTTGGG - Intronic
1128934298 15:71732212-71732234 ATTAGGATGTGGACATCTTTAGG + Intronic
1129914217 15:79254172-79254194 ATTAGGATGTGGACATCTTTGGG - Intergenic
1130202538 15:81845545-81845567 GTTAGAATGTGGACACCTTTGGG - Intergenic
1130320537 15:82837324-82837346 ATTAGGATGTGGACATCTTTGGG + Intronic
1131997450 15:98145937-98145959 ATTAGGAGGTGGACATCTTTTGG - Intergenic
1132018538 15:98339967-98339989 ATTAGGATGTGGACATCTTTGGG + Intergenic
1134150562 16:11801444-11801466 GTCAGCATGTGGACATCTTTGGG + Intergenic
1135286005 16:21193741-21193763 GTTAGCACGTGAATATCTTTGGG + Intergenic
1135353070 16:21746340-21746362 GTTCAGACATGGACATCTTTCGG - Intronic
1135451556 16:22562463-22562485 GTTCAGACATGGACATCTTTGGG - Intergenic
1135904957 16:26503136-26503158 GAATACAGATGGACATCTTTAGG - Intergenic
1135913675 16:26583709-26583731 ATTCAAAGATGGACATCTTTGGG + Intergenic
1136054259 16:27676482-27676504 ATTAGGATGTGGACATCTTTGGG + Intronic
1137583256 16:49647390-49647412 GTTAAGACTTGGACATCTTTGGG - Intronic
1139287321 16:65827201-65827223 TTTAAGACGTGGACATCTTTGGG + Intergenic
1139365945 16:66433747-66433769 GTAAACAGGTGGCCATCCTGTGG + Intronic
1139984494 16:70887178-70887200 ATTAGGATGTGGACATCTTTCGG - Intronic
1140657078 16:77151922-77151944 ATTAGGAGGTAGACATCTTTGGG - Intergenic
1140735607 16:77895319-77895341 ATTAGGATGTGGACATCTTTAGG - Intronic
1140793020 16:78410392-78410414 GTTAGGATGTGGACTTCTTTGGG + Intronic
1140959967 16:79902368-79902390 ATTAGGATGTGGACATCTTTGGG + Intergenic
1141978694 16:87535719-87535741 GTTAAGATATGGACATCTTTGGG + Intergenic
1143269223 17:5663557-5663579 GTGAGGATGTGGACATCTTTGGG - Intergenic
1143787714 17:9268564-9268586 GTTCACAGGAGGACGTCTTTAGG - Intronic
1144047776 17:11469139-11469161 ATTAGGAAGTGGACATCTTTGGG - Intronic
1144871389 17:18373908-18373930 ATTATTGGGTGGACATCTTTGGG - Intergenic
1144993517 17:19250468-19250490 GTTAAGATGTGGTTATCTTTGGG + Intronic
1150050075 17:61953322-61953344 ATTAGGATGTGGACATCTTTGGG - Intronic
1151874772 17:76861284-76861306 ATTAAGAGGTGGACATCTTTGGG + Intergenic
1154301897 18:13201400-13201422 ATTACCACATGGACATCTTTGGG + Intergenic
1155254125 18:23979769-23979791 GTTAGGATGTGGACATCTTTGGG - Intergenic
1156307038 18:35886864-35886886 ATTAGAATGTGGACATCTTTGGG + Intergenic
1157502153 18:48198808-48198830 ATTAGGATGTGGACATCTTTGGG + Intronic
1158301141 18:56054751-56054773 ATTAAAATGTGGATATCTTTTGG - Intergenic
1158870794 18:61685731-61685753 ATTAACATGTGGATATCTTGGGG + Intergenic
1158984189 18:62797206-62797228 TTTAAGATGTGAACATCTTTCGG - Intronic
1160015963 18:75141000-75141022 ACTAAGATGTGGACATCTTTGGG - Intergenic
1160269261 18:77369165-77369187 TTTAGGATGTGGACATCTTTGGG + Intergenic
1160286060 18:77544590-77544612 ATTATGATGTGGACATCTTTTGG + Intergenic
1161066786 19:2242565-2242587 ATTAGGATGTGGACATCTTTTGG + Intronic
1161567961 19:5013801-5013823 GTTAGGATGGGGACATCTTTGGG + Intronic
1161649492 19:5475613-5475635 ATTAGGATGTGGACATCTTTGGG - Intergenic
1161655429 19:5511478-5511500 ATTAGGATGTGGACATCTTTGGG + Intergenic
1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG + Intronic
1161995625 19:7709668-7709690 ATTAGAATGTGGACATCTTTGGG + Intergenic
1166031708 19:40136089-40136111 GTTAGGATGTGAACATCTTTGGG - Intergenic
1166932851 19:46311958-46311980 ATTAGGATGTGGACATCTTTGGG + Intronic
1167085485 19:47306962-47306984 ATTAAGATGTGGACATCATTGGG - Intronic
1167758434 19:51427709-51427731 ATTAGCAAGTGGACATCTTTGGG - Intergenic
1202702231 1_KI270712v1_random:173129-173151 GTTAGGACGTGGACATCTTTGGG - Intergenic
925515921 2:4681665-4681687 GTTAGGAGGGGGACATCTTGGGG + Intergenic
926463081 2:13157813-13157835 ATAAAGATGTGGACATCTTTGGG + Intergenic
926665040 2:15512435-15512457 ATTAGGATGTGGACATCTTTTGG - Intronic
928350807 2:30552020-30552042 ATTAAGATGTGGACATCTTTTGG + Intronic
929605160 2:43228703-43228725 GATAACATGTGGACATGTTACGG + Intergenic
930726001 2:54681920-54681942 ATTAGGATGTGGACATCTTTGGG + Intergenic
930800334 2:55437296-55437318 ATTAGGAGGTGTACATCTTTGGG - Intergenic
932129581 2:69175709-69175731 GTGAATATGTGGACATCTATAGG + Intronic
932269294 2:70395441-70395463 ATTAGCATGTGGACATATTTAGG + Intergenic
932558672 2:72848174-72848196 ATTAGGATGTGGACATCTTTTGG + Intergenic
933527110 2:83455750-83455772 ATTAAGACATGGACATCTTTGGG - Intergenic
934173145 2:89556576-89556598 GTTAGGACGTGGACATCTTTGGG - Intergenic
934283461 2:91630933-91630955 GTTAGGACGTGGACATCTTTGGG - Intergenic
934719360 2:96562596-96562618 ATTAGGATGTGGACATCTTTAGG - Intergenic
935109245 2:100076872-100076894 ATTAGGAGGTGGGCATCTTTGGG - Intronic
935403052 2:102680675-102680697 ATTAGGATGTGGACATCTTTGGG - Intronic
935662832 2:105484768-105484790 GTTGACAGGTGGAGGTCATTGGG + Intergenic
935674309 2:105581068-105581090 GTTTCAAGGTGGACATCTTGTGG - Intergenic
935725900 2:106023817-106023839 ATTAGGATGTGGACATCTTTGGG + Intergenic
935786089 2:106550080-106550102 GTTAGGATGTGAACATCTTTGGG + Intergenic
935946542 2:108291439-108291461 ATTAGGACGTGGACATCTTTAGG + Intronic
936924357 2:117721570-117721592 TTTAGGAGGTGGATATCTTTGGG - Intergenic
937157475 2:119731260-119731282 ATTAGAAAGTGGACATCTTTAGG - Intergenic
937459627 2:122074711-122074733 GTTACCAGGTGGAGGTTTTTAGG - Intergenic
937600117 2:123721399-123721421 GTTAGGATGTCGACATCTTTGGG + Intergenic
938071199 2:128309373-128309395 TGTATCAGGTGGACATCTCTGGG - Intronic
939073263 2:137568908-137568930 ATTAGGATGTGGACATCTTTGGG - Intronic
940208818 2:151235455-151235477 GTTAGGATGTGGACATCTTTGGG - Intergenic
940274270 2:151922561-151922583 ATTAGTATGTGGACATCTTTGGG + Intronic
941063844 2:160878575-160878597 ATTAGCATGTGGACATCTTTTGG + Intergenic
941704530 2:168643905-168643927 TTTAAGATGTGGATATCTTTGGG + Intronic
943280353 2:185924263-185924285 GTTAGAAGGTGAACATCTTTGGG + Intergenic
943957866 2:194216157-194216179 CTTAACAGGTGGCCAAATTTAGG - Intergenic
944314318 2:198269022-198269044 GTTAAAATGTGGACATCTTTAGG - Intronic
944482563 2:200172665-200172687 ATTAGGAAGTGGACATCTTTGGG + Intergenic
945121614 2:206463121-206463143 ATTAGGATGTGGACATCTTTAGG - Intronic
945195474 2:207233421-207233443 GTTAACAGGTGGGGACTTTTAGG + Intergenic
946055022 2:216893499-216893521 ATTAAGCTGTGGACATCTTTGGG - Intergenic
946436091 2:219655795-219655817 GAAAACAGGAGAACATCTTTGGG + Intergenic
946447678 2:219753734-219753756 ATTAGGTGGTGGACATCTTTGGG + Intergenic
947435688 2:230069991-230070013 ATTAGGATGTGGACATCTTTGGG + Intergenic
948026549 2:234782593-234782615 ATTAGGATGTGGACATCTTTGGG - Intergenic
948743577 2:240067570-240067592 ATTAAAATGTGGACATCATTAGG - Intergenic
1169780173 20:9301248-9301270 GTTAGGAGGTGGGTATCTTTTGG + Intronic
1171395372 20:24829588-24829610 ATTAGGAGGTGGACATCTTTGGG - Intergenic
1171461745 20:25301934-25301956 GCTCACAGGTGGCCATGTTTGGG - Intronic
1171955781 20:31462380-31462402 CTGATCAGGTGGACACCTTTGGG - Intergenic
1173127759 20:40355732-40355754 ATTAGGATGTGGACATCTTTGGG - Intergenic
1173888191 20:46480254-46480276 GTTAGGATGTGGACATGTTTGGG + Intergenic
1175496007 20:59414717-59414739 TTTAAGACATGGACATCTTTGGG + Intergenic
1176386179 21:6139532-6139554 GTAAACAGGAAGACAGCTTTCGG - Intergenic
1176720632 21:10389934-10389956 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720664 21:10390127-10390149 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720679 21:10390224-10390246 ATTAGGACGTGGACATCTTTGGG - Intergenic
1176720695 21:10390322-10390344 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720713 21:10390420-10390442 ATTAGGACGTGGACATCTTTGGG - Intergenic
1176720722 21:10390469-10390491 ATTAGTATGTGGACATCTTTGGG - Intergenic
1176720738 21:10390567-10390589 ATTAGGATGTGGACATCTTTGGG - Intergenic
1177036754 21:16054210-16054232 ATTAAGACATGGACATCTTTGGG - Intergenic
1177111175 21:17031193-17031215 GTTCTCAGGTGGTCATCTCTAGG + Intergenic
1177141532 21:17363021-17363043 ATTAGGATGTGGACATCTTTGGG - Intergenic
1177582914 21:23050951-23050973 ATTAAGAGATGGACATCTTTGGG - Intergenic
1177651718 21:23967341-23967363 TGGAACAGGTGGACCTCTTTTGG + Intergenic
1178182538 21:30179429-30179451 ATTAAGATGTGAACATCTTTGGG - Intergenic
1179041020 21:37802290-37802312 GTTAGGAAGTGGACATCTTTGGG - Intronic
1179167091 21:38943829-38943851 ATTAGGACGTGGACATCTTTGGG - Intergenic
1179453882 21:41485051-41485073 GTAAACAGGTGGGCATGTATGGG + Intronic
1179737294 21:43398720-43398742 GTAAACAGGAAGACAGCTTTCGG + Intergenic
1180301808 22:11042627-11042649 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301833 22:11042777-11042799 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301863 22:11042970-11042992 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301887 22:11043116-11043138 ATTAGGACGTGGACATCTTTGGG - Intergenic
1180301905 22:11043214-11043236 ATTAGGACGTGGACATCTTTGGG - Intergenic
1180301914 22:11043263-11043285 ATTAGTATGTGGACATCTTTGGG - Intergenic
1180301930 22:11043361-11043383 ATTAGGATGTGGACATCTTTGGG - Intergenic
1181883720 22:26002055-26002077 GTTAGAATGTGAACATCTTTGGG + Intronic
1182105460 22:27685872-27685894 ATGAACAGGTGAACATCTATGGG - Intergenic
1182883329 22:33752788-33752810 ATTAGGATGTGGACATCTTTTGG - Intronic
950741546 3:15056381-15056403 GTTAGGATGTGGACATCTCTGGG - Intronic
951307329 3:21081461-21081483 ATTAGAAGATGGACATCTTTGGG + Intergenic
951512989 3:23525296-23525318 ATTAGGATGTGGACATCTTTGGG + Intronic
952795155 3:37232756-37232778 GGTAATAGGTTGATATCTTTTGG - Intergenic
953542901 3:43838058-43838080 ATCAGCACGTGGACATCTTTGGG + Intergenic
953800251 3:46017525-46017547 GTTAACAGGAGACCATCTTTTGG - Exonic
955598528 3:60618626-60618648 ATTAAAACGTTGACATCTTTAGG - Intronic
955888406 3:63624651-63624673 GTTAGAATGTGAACATCTTTGGG + Intergenic
956336581 3:68171021-68171043 ATTAACACATGGGCATCTTTTGG - Intronic
957277277 3:78106999-78107021 GTTAGCACATGTACATCTTTGGG + Intergenic
957912728 3:86642596-86642618 TTTAAGATGTAGACATCTTTGGG + Intergenic
957940440 3:86996491-86996513 ATTAGAATGTGGACATCTTTGGG - Intergenic
959163299 3:102744491-102744513 ATTAAGATGTGGACATCTTACGG + Intergenic
959687106 3:109159379-109159401 ATTAGGATGTGGACATCTTTGGG + Intergenic
960027105 3:113021838-113021860 ATTAGCATGTGAACATCTTTGGG + Intergenic
960247486 3:115415260-115415282 ATTAGGACGTGGACATCTTTGGG + Intergenic
962979296 3:140473336-140473358 GTTCAGAGGTAGACATCTTTGGG - Intronic
963417820 3:145020869-145020891 ATGAGCACGTGGACATCTTTGGG - Intergenic
964316715 3:155452568-155452590 GTTATCAAGTGGAGATATTTAGG + Intronic
964562821 3:158016975-158016997 ATTAAGATGTGAACATCTTTGGG + Intergenic
964817363 3:160731098-160731120 ATTAGGATGTGGACATCTTTGGG + Intergenic
965188120 3:165491385-165491407 GCTAAGAGGTAGAGATCTTTAGG - Intergenic
965373299 3:167891239-167891261 ATTAAGATGTGGACATCTTTGGG + Intergenic
966335912 3:178868061-178868083 ATTAAAATGTGAACATCTTTGGG - Intergenic
966990460 3:185224982-185225004 ATTAGGACGTGGACATCTTTGGG + Intronic
967683796 3:192396644-192396666 CTTACCAGGTGGACATCTCAAGG + Intronic
969342771 4:6552741-6552763 ATTAGAATGTGGACATCTTTGGG + Intronic
969470870 4:7388562-7388584 GTGATCAGGTGGACACCTGTGGG - Intronic
969827001 4:9765438-9765460 GTTAGGACATGGACATCTTTGGG - Intergenic
970475970 4:16423314-16423336 GTTCACAGGTGAGCATCTTTAGG + Intergenic
970680669 4:18503946-18503968 GTTAGGATGTGGACACCTTTGGG + Intergenic
970906522 4:21223004-21223026 ATTAGGATGTGGACATCTTTGGG - Intronic
972297776 4:37756727-37756749 ATTGAGAGGTGGCCATCTTTGGG - Intergenic
972299198 4:37769177-37769199 ATTAAGATGTCGACATCTTTGGG - Intergenic
973334052 4:48938202-48938224 ATTAGGAGGTGGATATCTTTGGG - Intergenic
974276463 4:59726625-59726647 GTTGAGAGTTTGACATCTTTAGG + Intergenic
974449196 4:62029515-62029537 GTTAACATTTAGACATTTTTCGG + Intronic
974854021 4:67437993-67438015 ATTAGTATGTGGACATCTTTCGG - Intergenic
975211398 4:71704227-71704249 ATTAGAATGTGGACATCTTTGGG + Intergenic
976460265 4:85302753-85302775 GTTTACAGGAGGACATCAGTGGG + Intergenic
976567313 4:86566062-86566084 GTTAATATGTGCAAATCTTTTGG - Intronic
976936074 4:90635335-90635357 TTTAAAAGGTAGACATCTATGGG + Intronic
978504177 4:109438591-109438613 GTTAACAGAAAGAGATCTTTAGG - Intronic
978604995 4:110469876-110469898 ATTATCAAGTGGATATCTTTTGG + Intronic
979124544 4:116951216-116951238 ATTGACATGTGAACATCTTTGGG + Intergenic
979155379 4:117381223-117381245 ATTAGGATGTGGACATCTTTGGG + Intergenic
979308987 4:119179924-119179946 ATTAAGAGGTGGAGACCTTTGGG - Intronic
981339797 4:143608193-143608215 GTTAGAATGTGGATATCTTTGGG + Intronic
981912426 4:149997031-149997053 ATTAAGATGTGGACAACTTTGGG - Intergenic
982735952 4:159007160-159007182 GTAAACAGGTGGAGATCTTCAGG + Intronic
982871210 4:160581292-160581314 GTTTACAGATGGCCATCTTCTGG + Intergenic
982889956 4:160835007-160835029 ATTAGGATGTGGACATCTTTGGG - Intergenic
983756680 4:171347177-171347199 ATTAACATGTGGATCTCTTTGGG + Intergenic
985968963 5:3360433-3360455 GTTACGATGTGGACATATTTGGG - Intergenic
986460573 5:7966925-7966947 ATTAAGACGTGGACATCTTTGGG - Intergenic
987651137 5:20741507-20741529 ATTAAGAGCTGGATATCTTTGGG - Intergenic
988744424 5:34119944-34119966 ATTAAGAGCTGGATATCTTTGGG + Intronic
988875299 5:35438633-35438655 ATTAAGACATGGACATCTTTGGG + Intergenic
988931462 5:36039521-36039543 GCAGCCAGGTGGACATCTTTGGG + Exonic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
989598330 5:43178602-43178624 TTTAAAAGCTAGACATCTTTTGG + Intronic
989729646 5:44633393-44633415 GTTTAAATGTGGACATCTTTGGG - Intergenic
992272378 5:75078200-75078222 GTTATCAGGTACCCATCTTTGGG + Intronic
992318773 5:75588963-75588985 ATTAGGATGTGGACATCTTTAGG + Intronic
992379863 5:76226566-76226588 CTTACCAAATGGACATCTTTGGG - Intronic
993878439 5:93336315-93336337 GTTAGGACATGGACATCTTTGGG + Intergenic
995387161 5:111600696-111600718 ATTAACACGTGGACATCTTTGGG + Intergenic
995580912 5:113601196-113601218 GTTAAAGGGAGGACAGCTTTGGG - Intergenic
996945755 5:129065713-129065735 ATTAAGACGTAGACATCTTTTGG - Intergenic
997437993 5:133888983-133889005 ATGAACAGGTGGGCGTCTTTGGG - Intergenic
997624232 5:135320702-135320724 ATTAGGATGTGGACATCTTTAGG - Intronic
998977966 5:147669020-147669042 GTTAAAAAGTGGAAACCTTTGGG - Intronic
999889154 5:155957829-155957851 GTTAGGACATGGACATCTTTGGG + Intronic
1000276871 5:159745631-159745653 GTTAGGATATGGACATCTTTGGG - Intergenic
1000514000 5:162217926-162217948 ATTAAGAAATGGACATCTTTGGG + Intergenic
1001698138 5:173687858-173687880 ATTAAGACATGGACATCTTTGGG + Intergenic
1003487651 6:6593444-6593466 GTTAAGAGGTAGACATCTTTGGG + Intronic
1003878367 6:10458224-10458246 GTTAAGATGTGGATATCTTTTGG + Intergenic
1004576455 6:16900384-16900406 TTTAGGATGTGGACATCTTTGGG - Intergenic
1006764361 6:36491660-36491682 GTTAACAGGTTAACATCTCTGGG + Intergenic
1007646013 6:43381804-43381826 ATTAAGATGTGGATATCTTTGGG - Intergenic
1008873493 6:56301110-56301132 ATTAGGATGTGGACATCTTTGGG - Intronic
1008957881 6:57235601-57235623 GATAAGATGTGGACAACTTTGGG - Intergenic
1009596064 6:65738626-65738648 ATTAAAATGTGGACGTCTTTGGG - Intergenic
1009785524 6:68333372-68333394 GTTAGAAGGTAGACATCTATGGG + Intergenic
1011997758 6:93614806-93614828 ATTAGCACATGGACATCTTTGGG - Intergenic
1013204299 6:107932926-107932948 ATTAAGATGTGGACATCTTGGGG - Intronic
1014512545 6:122341975-122341997 GTTAGGACGTAGACATCTTTGGG - Intergenic
1015854766 6:137611655-137611677 ATTAAGAGGTGGGGATCTTTAGG + Intergenic
1016509937 6:144831170-144831192 ATTAGGATGTGGACATCTTTGGG - Intronic
1017935800 6:159003735-159003757 TTTAACAGGTCCCCATCTTTGGG + Intergenic
1018663325 6:166109549-166109571 GTTAACATCTGTACATCTTGGGG + Intergenic
1020931204 7:14397334-14397356 GTTAACATGTGGACTATTTTAGG + Intronic
1021631802 7:22654898-22654920 GTTCCCAGGTGGACAACTATTGG - Intergenic
1021930798 7:25579363-25579385 GGTAACTGGTGGACATCTAAGGG - Intergenic
1022514708 7:30968228-30968250 ATTAGGATGTGGACATCTTTGGG + Intronic
1022798124 7:33749067-33749089 GTTGCCTGGTGGCCATCTTTGGG + Intergenic
1022831579 7:34072711-34072733 ATTAGGAGGTGGACATGTTTGGG + Intronic
1022874182 7:34511793-34511815 ATTTAGACGTGGACATCTTTTGG - Intergenic
1023617081 7:42030372-42030394 ATTAGGATGTGGACATCTTTGGG + Intronic
1024130201 7:46344408-46344430 TTTAACAGCTAGACATATTTAGG - Intergenic
1026315141 7:69221299-69221321 CTGAGGAGGTGGACATCTTTGGG + Intergenic
1027943605 7:84717448-84717470 ATTAGGATGTGGACATCTTTGGG - Intergenic
1028049479 7:86164060-86164082 GTTACCAGGTGGAGGTCGTTAGG - Intergenic
1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG + Intronic
1028832885 7:95345485-95345507 TTTCTCAGGTGGACCTCTTTTGG + Intergenic
1029466143 7:100726055-100726077 GCTAAGAGGTGGACAGCCTTTGG - Intergenic
1030126978 7:106163090-106163112 GTTAAGAGGTGGGAGTCTTTGGG - Intergenic
1031132034 7:117843841-117843863 ATTAGGATGTGGACATCTTTGGG - Intronic
1031161658 7:118176140-118176162 ATTAGGATGTGGACATCTTTGGG + Intergenic
1031331231 7:120467118-120467140 ATTAAGATGTGAACATCTTTCGG + Intronic
1031534093 7:122912379-122912401 GTTAGCATGTAGACATCTTTAGG + Intergenic
1031909048 7:127494578-127494600 GTTCACAGATGGCCATCTTACGG + Intergenic
1032510756 7:132470514-132470536 ATTAGGATGTGGACATCTTTGGG - Intronic
1033765306 7:144483118-144483140 ATTAGAAGGTAGACATCTTTGGG - Intronic
1033856557 7:145568498-145568520 GTTAGGACGTGGGCATCTTTGGG + Intergenic
1033869377 7:145731969-145731991 ATTAAGAGGTGGATATCTTTTGG - Intergenic
1034017207 7:147599867-147599889 GTTTCCAGGTGGACATGATTTGG + Intronic
1034501014 7:151451203-151451225 ATTAAGACGTGGACATCTTTGGG + Intergenic
1036947996 8:13113274-13113296 CTTAACAGGGGGACATGTGTGGG + Intronic
1037420602 8:18697943-18697965 GTTAGGACATGGACATCTTTGGG - Intronic
1037574107 8:20184724-20184746 ATTAGGAGGTGGACATCTCTGGG + Intergenic
1037694632 8:21212901-21212923 TTTATCAAGTGGACTTCTTTTGG - Intergenic
1038424402 8:27455085-27455107 CTTAGGATGTGGACATCTTTGGG - Intronic
1038724757 8:30070949-30070971 TTTATAAGGTGGACATTTTTGGG - Intronic
1038747306 8:30265850-30265872 GTTAAAAAGTGGACATTCTTGGG - Intergenic
1039077407 8:33704238-33704260 ATTAGGATGTGGACATCTTTGGG - Intergenic
1039997955 8:42550756-42550778 GTTAAGATGTGGACATCTTTGGG + Intronic
1040398007 8:47018140-47018162 GTAAGCATGTGGACCTCTTTGGG - Intergenic
1042481206 8:69304897-69304919 TTTGACAGGTGGAAATTTTTAGG + Intergenic
1043510716 8:80947626-80947648 ATTAGGATGTGGACATCTTTGGG + Intergenic
1044355303 8:91215202-91215224 ATTAGGATGTGGACATCTTTGGG + Intronic
1044630869 8:94277657-94277679 CTTAAAAGGTGGACATTTCTGGG - Intergenic
1046070547 8:109247892-109247914 ATTTAGATGTGGACATCTTTGGG - Intronic
1047407221 8:124595726-124595748 GTTAGAACGTGGACATCTTTGGG + Intronic
1047560038 8:125977364-125977386 ATTGAGATGTGGACATCTTTGGG - Intergenic
1047700892 8:127448387-127448409 GTTAAGATGTGGACATCTTTGGG - Intergenic
1048518976 8:135136601-135136623 GTTTAGATGTGGACATCTTTGGG - Intergenic
1049647872 8:143744291-143744313 GGCAGGAGGTGGACATCTTTGGG + Intergenic
1050716908 9:8539681-8539703 GTTTACTGGTGGTCATATTTAGG - Intronic
1051723039 9:20059071-20059093 ATTAGGAAGTGGACATCTTTAGG - Intergenic
1051741625 9:20258113-20258135 GTTAGGACTTGGACATCTTTGGG - Intergenic
1051791296 9:20805627-20805649 GTTAACAGTTCCATATCTTTTGG - Intronic
1054734506 9:68736873-68736895 ATTAGGATGTGGACATCTTTGGG + Intronic
1054736856 9:68761887-68761909 GTAAGGATGTGGACATCTTTTGG + Intronic
1054744502 9:68840872-68840894 GTTAGGATGTGGACATCTTTGGG + Intronic
1054907933 9:70427099-70427121 ATTAAGATGTGGATATCTTTGGG - Intergenic
1055086332 9:72317860-72317882 ATTAGAAGGTGGACATCTTCAGG - Intergenic
1055567994 9:77588216-77588238 ATTCAGAGGGGGACATCTTTGGG + Intronic
1055722100 9:79186480-79186502 GTTAGGATGTGGACAGCTTTAGG + Intergenic
1056028294 9:82524292-82524314 GTTAAGATATGGAAATCTTTGGG + Intergenic
1056821732 9:89847045-89847067 ATTAGAATGTGGACATCTTTGGG - Intergenic
1056899972 9:90589053-90589075 ATTAGGATGTGGACATCTTTGGG + Intergenic
1058002912 9:99884894-99884916 GTTAACAGGTGGAAAGATTCTGG + Intergenic
1058123354 9:101163771-101163793 GTTAGCAGATGTAAATCTTTTGG + Intronic
1058888899 9:109344047-109344069 GTTAGCAGGTGGAGAAGTTTGGG - Intergenic
1059087119 9:111316184-111316206 ATTAAGACATGGACATCTTTAGG - Intergenic
1059573005 9:115460453-115460475 ATTAGAATGTGGACATCTTTGGG - Intergenic
1059753375 9:117270060-117270082 GATAAAAGGTGGACAAATTTGGG - Intronic
1060315785 9:122509205-122509227 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185453689 X:296794-296816 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453700 X:296843-296865 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453710 X:296892-296914 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453719 X:296941-296963 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453727 X:296990-297012 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453736 X:297039-297061 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453754 X:297137-297159 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453763 X:297186-297208 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453771 X:297235-297257 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453788 X:297333-297355 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453799 X:297382-297404 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453810 X:297431-297453 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453820 X:297480-297502 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453830 X:297529-297551 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453838 X:297578-297600 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453848 X:297627-297649 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453856 X:297676-297698 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453866 X:297725-297747 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453874 X:297774-297796 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453883 X:297823-297845 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453891 X:297872-297894 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453899 X:297921-297943 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453907 X:297970-297992 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453917 X:298019-298041 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453925 X:298068-298090 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453933 X:298117-298139 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453941 X:298166-298188 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453951 X:298215-298237 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453959 X:298264-298286 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453969 X:298313-298335 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453978 X:298362-298384 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453986 X:298411-298433 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453994 X:298460-298482 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454004 X:298509-298531 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454012 X:298558-298580 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454020 X:298607-298629 ATTACGACGTGGACATCTTTGGG + Intronic
1185454030 X:298656-298678 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454048 X:298754-298776 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454056 X:298803-298825 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454065 X:298852-298874 ATTAGGATGTGGACATCTTTGGG + Intronic
1185540262 X:897711-897733 ATTAGAATGTGGACATCTTTAGG + Intergenic
1185540271 X:897760-897782 ATTAGGATGTGGACATCTTTAGG + Intergenic
1185572581 X:1146125-1146147 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572589 X:1146174-1146196 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572599 X:1146223-1146245 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572607 X:1146272-1146294 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572615 X:1146321-1146343 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572625 X:1146370-1146392 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572633 X:1146419-1146441 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572642 X:1146468-1146490 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572650 X:1146517-1146539 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572657 X:1146566-1146588 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572664 X:1146615-1146637 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572672 X:1146664-1146686 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572679 X:1146713-1146735 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572689 X:1146762-1146784 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572698 X:1146811-1146833 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572707 X:1146860-1146882 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572715 X:1146909-1146931 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572723 X:1146958-1146980 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572741 X:1147055-1147077 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572752 X:1147104-1147126 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572760 X:1147153-1147175 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572768 X:1147202-1147224 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572779 X:1147251-1147273 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572788 X:1147300-1147322 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185596846 X:1312418-1312440 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185596861 X:1312514-1312536 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185650972 X:1647912-1647934 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185650992 X:1648009-1648031 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185708976 X:2287295-2287317 ATTAGGATGTGGACATCTTTGGG - Intronic
1185709041 X:2287637-2287659 ATTAGGATGTGGACATCTTTGGG - Intronic
1185709052 X:2287685-2287707 ATTAACATATGGACATCTTTGGG - Intronic
1185709066 X:2287783-2287805 ATTAGGATGTGGACATCTTTGGG - Intronic
1185743827 X:2555550-2555572 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185743867 X:2555749-2555771 ATTAGAATGTGGACATCTTTGGG + Intergenic
1185743877 X:2555799-2555821 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185751851 X:2617594-2617616 ATTTACAGGTGAACCTCTTTAGG - Intergenic
1185793523 X:2945599-2945621 ATTAGGATGTGGACATCTTTGGG + Intronic
1185882558 X:3754590-3754612 ATTCAGATGTGGACATCTTTGGG - Intergenic
1185922346 X:4107697-4107719 ATTAGGATGTGGACATCTTTGGG - Intergenic
1185922363 X:4107838-4107860 ATTAAGATGTGGGCATCTTTGGG - Intergenic
1185922374 X:4107888-4107910 ATTAAGATGTGGGCATCTTTGGG - Intergenic
1185922385 X:4107939-4107961 ATTAAGATGTGGACATCTTTGGG - Intergenic
1186024226 X:5291177-5291199 ATTAGGATGTGGACATCTTTGGG + Intergenic
1186031819 X:5376534-5376556 ATTAAGATGTAGACATCTTTGGG + Intergenic
1186289007 X:8076458-8076480 ATTAGCAGGTGGACATCTCTGGG - Intergenic
1186559711 X:10598409-10598431 GGCTTCAGGTGGACATCTTTGGG - Intronic
1186730799 X:12407230-12407252 GTTAAAATGCAGACATCTTTGGG + Intronic
1188329280 X:28848592-28848614 GCTAAAAGGTAGACAGCTTTTGG - Intronic
1188369012 X:29346288-29346310 TTTAGCATGTGGACATCTTTGGG + Intronic
1188828463 X:34866176-34866198 ATTAGGACGTGGACATCTTTAGG + Intergenic
1189084394 X:38005378-38005400 TTTAACAACTGGACATTTTTGGG - Intronic
1189120934 X:38394115-38394137 GTTAGGACATGGACATCTTTGGG + Intronic
1190315988 X:49151379-49151401 ATTAGGAGGTGAACATCTTTGGG + Intergenic
1191838408 X:65490095-65490117 ATTAAAATGTGGACATCTCTAGG - Intronic
1193142485 X:78042476-78042498 TTTAAAATGTGGACATCTTGTGG + Intronic
1195026484 X:100882777-100882799 CTTAGGATGTGGACATCTTTAGG - Intergenic
1195634164 X:107094565-107094587 ATTAGGATGTGGACATCTTTGGG - Intronic
1196632647 X:117961457-117961479 GTTAAGATGTGGACATCTTTAGG - Intronic
1196636170 X:118005431-118005453 ATTAAGATGTGGACATCTTTGGG - Intronic
1198458666 X:136842525-136842547 ATTAAGATGTAGACATCTTTGGG - Intergenic
1198525843 X:137499872-137499894 ATAAACAAATGGACATCTTTGGG + Intergenic
1199666055 X:150097409-150097431 ATTAGGACGTGGACATCTTTGGG + Intergenic
1199876931 X:151939985-151940007 ATTAGGAGGTGGATATCTTTTGG - Intergenic
1200782435 Y:7228724-7228746 ATTCAGATGTGGACATCTTTGGG + Intergenic
1200872709 Y:8121043-8121065 GTGACCAGGTGGACACCTTGGGG + Intergenic
1201254045 Y:12089554-12089576 ATTAGAATGTGGACATCTTTGGG + Intergenic
1201594799 Y:15656265-15656287 ATTAAAACATGGACATCTTTAGG - Intergenic