ID: 1028460583

View in Genome Browser
Species Human (GRCh38)
Location 7:91087460-91087482
Sequence CACAGCTCAGTAGTGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028460583 Original CRISPR CACAGCTCAGTAGTGGAACT AGG (reversed) Intronic
901143911 1:7052698-7052720 CACAGCTCAGGAGGAGAACCAGG - Intronic
903357759 1:22758558-22758580 CACAGCTCAGGCGTGGCACAAGG - Intronic
903592987 1:24471275-24471297 CAAAGCTAAGTAGTGGAAGCTGG + Intronic
907683490 1:56586773-56586795 CACAGATCAGTAGTGGTGCGTGG - Intronic
911032786 1:93508019-93508041 CACTTCTCAGGAGAGGAACTGGG - Intronic
914336995 1:146724564-146724586 CACAGCTCATTGGTGGGACCAGG + Intergenic
914442267 1:147718069-147718091 CACAACTCAGTAGGGGCACCGGG - Intergenic
916054113 1:161056113-161056135 CACAGCACAGTGGTGAGACTTGG - Intronic
916127032 1:161580882-161580904 CACTGCTGAGTTGTGGAACAAGG - Intergenic
916136952 1:161662686-161662708 CACTGCTGAGTTGTGGAACAAGG - Intronic
916193669 1:162203349-162203371 CACAGACCAGTAGTGGAATCTGG - Intronic
917322630 1:173799491-173799513 AATATCTCAGTAGTGGAAATTGG - Intergenic
917823093 1:178786608-178786630 CACAACTAAGTGGTGGAACTGGG + Intronic
920736839 1:208540558-208540580 CACTGCTAAGTAATAGAACTGGG - Intergenic
921758618 1:218886620-218886642 CAGAGCTGAGTAGTGGCAGTGGG - Intergenic
922208203 1:223467261-223467283 CACAGCTCAGAACTGGAGCCTGG - Intergenic
1063597214 10:7446549-7446571 AACTGCTGAGGAGTGGAACTAGG - Intergenic
1067784840 10:49238018-49238040 CACAGCTGAGTAGTGGCATAGGG + Intergenic
1068094038 10:52468318-52468340 CACAGCTCAAATGTGGCACTTGG + Intergenic
1069312572 10:67056495-67056517 TACAGATCAGGAGTGGATCTTGG - Intronic
1071141012 10:82509614-82509636 CATGGCTCAGAAGGGGAACTAGG + Intronic
1071378978 10:85038605-85038627 CTCAGCTCGGTTCTGGAACTTGG - Intergenic
1076265794 10:129109100-129109122 CAGAGCTCAGGAGGGGAATTGGG + Intergenic
1078523816 11:12085598-12085620 CACAGCTCAGGAGTGGCCCTGGG + Intergenic
1079160285 11:17986128-17986150 AGCAGCTCATTAGTGGAACAAGG - Intronic
1079579782 11:22049325-22049347 GGGAGCTCAGTAGTGGAACAAGG + Intergenic
1084934530 11:72579746-72579768 CAGAGCTCAGAAAGGGAACTGGG - Intronic
1087242424 11:95794242-95794264 TACAGCTCAGTAGTGGGTCATGG + Intronic
1087856033 11:103092458-103092480 AAGAGCTCAGAAGTGGAACTTGG - Intergenic
1091747292 12:3000485-3000507 CAGAGCGCAGGAGTGGGACTGGG - Intronic
1091899371 12:4132780-4132802 ATCAGTTCAGTAGTAGAACTGGG - Intergenic
1091942903 12:4505651-4505673 CACAGATAAGTAGTGGAGCCAGG + Intronic
1092946049 12:13455135-13455157 CACTTCTCAGAAGTGGTACTTGG + Intergenic
1094215084 12:27932060-27932082 CAGCGCTCAGTAGAGGGACTCGG - Intergenic
1100853624 12:98739107-98739129 CACAGCCAAGTGGTGGAGCTGGG + Intronic
1101640683 12:106584002-106584024 CACAGCTCCCTAGTGGAGCCCGG - Intronic
1101956819 12:109219130-109219152 CAGAGCTGAGTAGTGGCAATAGG - Intronic
1104308435 12:127631934-127631956 TACAGCCCAATAGTGGAACAGGG - Intergenic
1104311094 12:127654982-127655004 CCCTGCTCAGGAGTGGAAGTGGG + Intergenic
1104311304 12:127656313-127656335 CCCTGCTCAGGAGTGGAAGTGGG - Intergenic
1107137505 13:36960376-36960398 CACAGCTATGGAGTGGAAATTGG + Intronic
1107347266 13:39475126-39475148 CAGAGCTGAGTAGTGGAGCTGGG + Intronic
1117574915 14:57088136-57088158 CACAGCTCTGTAGTTTATCTAGG + Intergenic
1119064327 14:71510653-71510675 CACAGCTATGAAGTGGTACTGGG - Intronic
1119280447 14:73402492-73402514 CACAACTATGTAGTGTAACTAGG + Intronic
1119326394 14:73762098-73762120 CACAGGTCTGCAGAGGAACTTGG - Intronic
1121635197 14:95449518-95449540 CACAGCTCAGTGGTGTCACCAGG - Intronic
1122159878 14:99775258-99775280 CAGAGCTCAGTGGGTGAACTAGG + Intronic
1122777615 14:104128646-104128668 CACTGCCAAGAAGTGGAACTTGG - Intergenic
1125430351 15:39587633-39587655 CACAGCTAAGCAGTGGGATTGGG - Intronic
1128684703 15:69675070-69675092 CACAGCTGAGTAGGGGAGCCAGG - Intergenic
1130406777 15:83609706-83609728 CACAGCTCTTTTGTGGAACTTGG - Intronic
1130608757 15:85341483-85341505 CACAGCTCAGTTTTGCAGCTTGG - Intergenic
1130650064 15:85757325-85757347 CACATTACAGCAGTGGAACTGGG - Intergenic
1131492964 15:92878849-92878871 CACAGCTCAGCAATAGAACAGGG - Intergenic
1132700391 16:1219790-1219812 CACAGGTCAGGAGTGAGACTAGG + Intronic
1135266367 16:21029767-21029789 CACAGCTCAATAGTAGAGTTAGG - Intronic
1135344943 16:21681024-21681046 CACAACTAAGTGATGGAACTAGG + Intronic
1136746937 16:32598652-32598674 CACAGGTCTGCAGAGGAACTTGG - Intergenic
1138264182 16:55647695-55647717 CACAGAGAAGTAGGGGAACTTGG + Intergenic
1138580483 16:57937782-57937804 CACAGCCCAGTTGGGGAACCAGG - Intronic
1139997274 16:70992755-70992777 CACAGCTCATTGGTGGGACCAGG - Intronic
1140888908 16:79268541-79268563 CACATTTCTGTAGTCGAACTAGG + Intergenic
1141443961 16:84046315-84046337 CACAGCACAGGAGTGGCACGTGG + Intergenic
1142065206 16:88058436-88058458 CACAGCACTGCCGTGGAACTGGG - Intronic
1203049067 16_KI270728v1_random:857856-857878 CACAGGTCTGCAGAGGAACTTGG - Intergenic
1142942847 17:3397302-3397324 CATAGCTGAGTAGTTGAACTAGG - Exonic
1142947489 17:3444290-3444312 CACAGTTCACTCGTGGATCTGGG - Intronic
1144842170 17:18193907-18193929 TGCAGCTCAGTAGAGTAACTTGG + Intronic
1145301978 17:21647241-21647263 CACAGCTGCGTAGTGGAGTTTGG + Intergenic
1145328324 17:21849997-21850019 CACAGCTGCGTAGTGGAGTTTGG + Intergenic
1145348332 17:22056075-22056097 CACAGCTGCGTAGTGGAGTTTGG - Intergenic
1145695107 17:26781341-26781363 CACAGCTGTGTAGTGGAGTTTGG + Intergenic
1146281229 17:31545983-31546005 CCCAGCTGAGAAGTGGACCTGGG + Intergenic
1147993955 17:44351321-44351343 GACAGGTCAGAAGTGGCACTGGG - Intronic
1148109184 17:45135264-45135286 CACAGCTCAGTTTTGGAAGATGG - Intronic
1149596311 17:57866730-57866752 CAGAGCTCAGTGGTGGACCCTGG - Intronic
1151433896 17:74082311-74082333 CACAGCTCATTAGTGGCAGAGGG + Intergenic
1203192926 17_KI270729v1_random:206175-206197 CACAGCTGCGTAGTGGAGTTTGG + Intergenic
1203202290 17_KI270730v1_random:5610-5632 CACAGCTGCGTAGTGGAGTTTGG + Intergenic
1153855565 18:9142313-9142335 CACAGCTCAGTAGCAGAACAAGG + Intronic
1160353701 18:78208050-78208072 CACAGCACAGCTGTGGAACCCGG + Intergenic
1161266975 19:3368644-3368666 CCCAGCCCTGTAGTGGAGCTGGG + Intronic
1165423824 19:35734853-35734875 CACAGCTCAGTTGCTGAGCTGGG + Intronic
1165831665 19:38733618-38733640 CACAGCTGAGCAGGGGGACTTGG + Intronic
1166276891 19:41760403-41760425 CACAGCTGAGTGGTGGAAAGGGG - Intronic
1167715735 19:51141960-51141982 CGTAGCTCAGAAGTGGGACTCGG - Intergenic
925173479 2:1766983-1767005 CAGAGCTCAGCAGGGGGACTGGG - Intergenic
925691601 2:6529638-6529660 CACAGCTCAAGTGAGGAACTTGG - Intergenic
926735083 2:16067834-16067856 CTCAGCTAAGTAGTTGAGCTGGG + Intergenic
927074359 2:19562867-19562889 CAGATCTCACTAGTGCAACTTGG + Intergenic
928927629 2:36595581-36595603 CACAGACCGGTACTGGAACTGGG - Intronic
930091944 2:47537302-47537324 CACTGCTCAGTTGTGAAAATGGG + Intronic
934459920 2:94208315-94208337 CACAGCTGGGGAGTGGACCTGGG + Intergenic
937266303 2:120616684-120616706 CACAGGTGAGTAGTGGAGCCAGG + Intergenic
937312744 2:120912024-120912046 CACACCTCAGTAGGGGGACCAGG - Intronic
938907613 2:135853638-135853660 CACAGTTAAGTAGTGGAGCCAGG + Intronic
944556151 2:200889540-200889562 CACAGCGCACTAGTGGGACAGGG + Exonic
945571326 2:211471587-211471609 CACAGTTAAGAGGTGGAACTGGG + Intronic
945835157 2:214830984-214831006 AAGAGCTCATTAGGGGAACTTGG - Intergenic
1168810939 20:704178-704200 CACCGCTCAGAAGTTGTACTCGG + Intergenic
1169758405 20:9067457-9067479 TACAGCTTAGTAGTTGAGCTGGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1170695328 20:18652561-18652583 CACTGCTCAAAAGTGGAGCTAGG - Intronic
1170881205 20:20297873-20297895 CCCAGCTAATAAGTGGAACTGGG - Intronic
1171558296 20:26097566-26097588 CACAGCTGTGTAGTGGAGTTTGG - Intergenic
1173234645 20:41233599-41233621 CACAGTGCAGTAGGGGAACATGG + Intronic
1175164814 20:57035962-57035984 CACAGTACAGAGGTGGAACTTGG - Intergenic
1178198578 21:30377149-30377171 CACAGCTAAGTGATGGAGCTGGG - Intronic
1178977591 21:37232851-37232873 CTCAGCTCAGTGGTGGAGCTGGG + Intronic
1179402587 21:41097712-41097734 TACAGTGCAGTAGTGGAAATGGG - Intergenic
1179722452 21:43323471-43323493 AGCAGGTCAGCAGTGGAACTGGG + Intergenic
1179898382 21:44376165-44376187 CACAGGTCATTCGTGGCACTCGG + Intronic
1182970215 22:34566679-34566701 CACAGCTCAGGAGGGAAAATGGG + Intergenic
952824573 3:37514274-37514296 CACAGCTAAGAAGTGGGGCTGGG + Intronic
956827395 3:73011020-73011042 TACAGCTAAGTAATGGAACTGGG + Intronic
959993401 3:112653966-112653988 CACAGCTGAGCAGGGCAACTTGG + Intergenic
962865993 3:139448396-139448418 CACAGCTCAGCAGTGGCAGAGGG - Intergenic
962920420 3:139945233-139945255 CACAACTCATCAGTGGATCTAGG - Intronic
963893370 3:150660186-150660208 CAGAGTCCAGAAGTGGAACTGGG + Intronic
963930345 3:150998118-150998140 CACAGTTCAGTAGTGCAATTTGG - Intergenic
967688308 3:192443317-192443339 CACAACTCAGTTGTGGATATAGG - Intronic
972144946 4:36011791-36011813 CACAGCATATTAGTGGAATTAGG + Intronic
974853973 4:67437334-67437356 CACAGCTCAGTGGTGGAACTAGG + Intergenic
975526800 4:75360060-75360082 CACAGCTAAGCAATAGAACTGGG + Intergenic
982800703 4:159702784-159702806 CACCGCTCAGCACTGGAACTGGG + Intergenic
983967466 4:173830372-173830394 CACATGTCAGAAGTGGAACCAGG + Intergenic
984056919 4:174941829-174941851 CACAGGTGAGTATTTGAACTTGG - Intronic
986104207 5:4644250-4644272 CAATGCTCAGCAGTGGAACGTGG + Intergenic
986574033 5:9194093-9194115 CACAGCTCAGCTGTGCCACTGGG + Intronic
991613553 5:68472843-68472865 CACAGATCAGAGGTGGAGCTGGG - Intergenic
993792972 5:92230182-92230204 CAGAGCTCAGCAGTGGCAATGGG - Intergenic
995192565 5:109333697-109333719 CACAGTTCTGTGGTCGAACTAGG - Intergenic
996315883 5:122160058-122160080 CACAGCTGAGGAGGTGAACTAGG - Intronic
996464574 5:123784711-123784733 CACAGCTCTGTCTTGGAACATGG + Intergenic
1000993882 5:167939411-167939433 CACAGGCCAGTACAGGAACTGGG - Intronic
1001428590 5:171642035-171642057 AAGAGCTCAGTTATGGAACTTGG + Intergenic
1001986408 5:176077030-176077052 CACAGGTCTGCAGAGGAACTTGG - Intronic
1002230459 5:177761095-177761117 CACAGGTCTGCAGAGGAACTTGG + Intronic
1002264877 5:178022652-178022674 CACAGGTCTGCAGAGGAACTTGG - Intronic
1002721142 5:181261927-181261949 CAGAGCTCAGGGCTGGAACTCGG - Intergenic
1003650065 6:7951289-7951311 CACCCTTCAGTTGTGGAACTAGG - Intronic
1004311949 6:14553794-14553816 CACAGATCAGTAGTGGCCCGTGG + Intergenic
1010376160 6:75173244-75173266 CACAGCTAAGCAGTACAACTGGG + Intronic
1013975584 6:116074719-116074741 CACAGATGAGAAGTGGACCTGGG - Intergenic
1017995994 6:159532169-159532191 CACATGTCAGTGATGGAACTCGG + Intergenic
1018472836 6:164111861-164111883 CTCAGCTCAGCTGTGGAGCTGGG + Intergenic
1020109584 7:5440455-5440477 AACTGCTCAGTAGTGGCACATGG + Intronic
1025198212 7:56947787-56947809 CACAACTCAGTAGAGGAAGAAGG + Intergenic
1028460583 7:91087460-91087482 CACAGCTCAGTAGTGGAACTAGG - Intronic
1032381458 7:131487446-131487468 CACAGCCAGGTAGTAGAACTGGG + Intronic
1033493261 7:141865465-141865487 CAGAGCTGAGTAGTGGTACTGGG + Intergenic
1036980209 8:13461761-13461783 CACAGCTAAGTAGTGGCAGAGGG + Intronic
1037632611 8:20671945-20671967 CACAGCACAGCAGTGGAACAGGG - Intergenic
1038080522 8:24130464-24130486 CACAGCTCTGTAGCAGAGCTTGG + Intergenic
1038212614 8:25533559-25533581 CACAGTTAAGTGGTGGAGCTGGG - Intergenic
1038351047 8:26776577-26776599 CAAAGATCAGGAGTGGAAATGGG - Intronic
1039270368 8:35874108-35874130 CACAGCCCAGTGGGGGAACGCGG - Intergenic
1039373567 8:37011244-37011266 CACAGCTAAGTATTGGAGCTGGG - Intergenic
1039889162 8:41672643-41672665 CACAGGTCACGAGTGGAAGTTGG - Exonic
1042154810 8:65832974-65832996 CACAATTAAGTAGTGGAAATGGG - Intronic
1044430281 8:92101067-92101089 CATAGAACAGGAGTGGAACTGGG - Intronic
1047028058 8:120846318-120846340 CACAGAGCAATAGTTGAACTCGG - Intergenic
1047411552 8:124628490-124628512 CACGGCTCAGCTGTGGAACCTGG + Intronic
1047470942 8:125171412-125171434 AAGAGCTCAGTATTGGAGCTAGG - Intronic
1048819761 8:138369907-138369929 CAGAGATCAGGAGGGGAACTGGG - Intronic
1050603060 9:7272160-7272182 CACAGCTCAGTAGGGGTCCTAGG + Intergenic
1051114224 9:13675591-13675613 CACAGCTCAGTAATGCTTCTAGG + Intergenic
1052743582 9:32417102-32417124 CACTAGTCAGTGGTGGAACTGGG - Intronic
1057243484 9:93433974-93433996 GACAGCTCAGTAGAGCATCTGGG + Intergenic
1057606192 9:96499276-96499298 CACAGCTCCTTGGGGGAACTGGG + Intronic
1057733227 9:97630196-97630218 CATGGCTCATTTGTGGAACTGGG - Intronic
1060996438 9:127877006-127877028 CACAGCTGAGTGATGGAGCTGGG - Intronic
1061432357 9:130539190-130539212 TACAGCTCAGTAGTGGCACAGGG + Intergenic
1061593041 9:131610689-131610711 CACAGCTCAGCACTGGCGCTGGG + Intronic
1062388170 9:136323126-136323148 CACAGCTGGGGAGTGGATCTGGG + Intergenic
1186345194 X:8684789-8684811 CACAGCTGAATGGTTGAACTTGG - Intronic
1187215023 X:17267761-17267783 GTCAGCTCAGAAGTGGATCTGGG + Intergenic
1192170284 X:68850466-68850488 CATAACTCAGGAGGGGAACTAGG - Intergenic
1196888653 X:120271324-120271346 CAGAGCTGAGTAGCAGAACTGGG - Intronic
1198214241 X:134542627-134542649 TAGAGCTCAGTAGTGGAAGGGGG + Intergenic
1200108411 X:153726689-153726711 CCCAGCACAGCAGTGGGACTTGG + Intronic
1201674007 Y:16558748-16558770 GACAGATCAGTAGTGGTTCTTGG + Intergenic
1202379895 Y:24267595-24267617 CACAGCTCAGTTTTGCAGCTTGG - Intergenic
1202490887 Y:25402526-25402548 CACAGCTCAGTTTTGCAGCTTGG + Intergenic