ID: 1028471436

View in Genome Browser
Species Human (GRCh38)
Location 7:91211013-91211035
Sequence TTGTATTTGTATTCAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028471436_1028471439 -6 Left 1028471436 7:91211013-91211035 CCCTCCACTGAATACAAATACAA No data
Right 1028471439 7:91211030-91211052 ATACAAAAGCTTGAGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028471436 Original CRISPR TTGTATTTGTATTCAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr