ID: 1028471717

View in Genome Browser
Species Human (GRCh38)
Location 7:91213191-91213213
Sequence CAGCCTTTCTTGAGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028471717_1028471719 -2 Left 1028471717 7:91213191-91213213 CCTTTCTTCCTCAAGAAAGGCTG No data
Right 1028471719 7:91213212-91213234 TGTAATCCACTAAGATTCCCTGG No data
1028471717_1028471720 -1 Left 1028471717 7:91213191-91213213 CCTTTCTTCCTCAAGAAAGGCTG No data
Right 1028471720 7:91213213-91213235 GTAATCCACTAAGATTCCCTGGG No data
1028471717_1028471722 8 Left 1028471717 7:91213191-91213213 CCTTTCTTCCTCAAGAAAGGCTG No data
Right 1028471722 7:91213222-91213244 TAAGATTCCCTGGGAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028471717 Original CRISPR CAGCCTTTCTTGAGGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr