ID: 1028473124

View in Genome Browser
Species Human (GRCh38)
Location 7:91225774-91225796
Sequence CAGTGAGTGTATTTTGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028473124_1028473132 30 Left 1028473124 7:91225774-91225796 CCATATGCAAAATACACTCACTG No data
Right 1028473132 7:91225827-91225849 GCTGTTACAGCCCCAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028473124 Original CRISPR CAGTGAGTGTATTTTGCATA TGG (reversed) Intergenic
No off target data available for this crispr