ID: 1028473696

View in Genome Browser
Species Human (GRCh38)
Location 7:91231514-91231536
Sequence CTGTGAACTAGGACCTACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028473693_1028473696 26 Left 1028473693 7:91231465-91231487 CCTTATGCACATTTATTCATTTA No data
Right 1028473696 7:91231514-91231536 CTGTGAACTAGGACCTACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028473696 Original CRISPR CTGTGAACTAGGACCTACGA TGG Intergenic
No off target data available for this crispr