ID: 1028477832

View in Genome Browser
Species Human (GRCh38)
Location 7:91270302-91270324
Sequence GTTTTCCACTTAAGCTTTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028477832 Original CRISPR GTTTTCCACTTAAGCTTTGT GGG Exonic
900895669 1:5481368-5481390 GGTTTCCACTTAAACTATGTTGG - Intergenic
901488813 1:9585306-9585328 GTTTTTCTCTTAATTTTTGTGGG + Intergenic
905100000 1:35511864-35511886 TTTTTCCACTTAAGTTATGAGGG - Intronic
908238016 1:62166084-62166106 GTTTTCCAATAAACCTTAGTGGG + Intergenic
908266966 1:62388973-62388995 GATTTCAATTTAAGCTTTTTTGG - Intergenic
910203043 1:84719598-84719620 TTTTTCCACTCATGCATTGTTGG - Intergenic
914394349 1:147250674-147250696 GCTTTCCACTTAGCCTTTGCTGG + Intronic
915457859 1:156052756-156052778 GTTTTCAAATTCAGCTTTGTAGG + Intronic
917288805 1:173450106-173450128 GTTATCCTCTTAAGGTCTGTGGG - Intergenic
919583880 1:199411138-199411160 GTTTGGAACTCAAGCTTTGTGGG - Intergenic
921045781 1:211477088-211477110 GTTCTACACTTAAGTTTTCTTGG - Exonic
921421114 1:214949468-214949490 GCTTTCAAATTAAGTTTTGTGGG + Intergenic
921893309 1:220373940-220373962 GTTTTCAACACAAGCTTTTTGGG + Intergenic
922245537 1:223793125-223793147 GTTTTCCTTTTAGGCATTGTGGG - Intronic
922660177 1:227423208-227423230 GTTTTCCATTTAATCTTTTTGGG + Intergenic
1063071126 10:2665368-2665390 GATTTCCACTTAATTTTTGAAGG - Intergenic
1063125450 10:3132987-3133009 ATTTTCCATTTAATATTTGTGGG + Intronic
1066670535 10:37833269-37833291 GTTTTCCACCTAAACCTTGGAGG - Intronic
1068072542 10:52213912-52213934 GTTTTCCTTTTAAGATTTCTAGG - Intronic
1072178716 10:92957669-92957691 GTTTTCATCTTAAGATTTGAAGG + Intronic
1076165021 10:128274820-128274842 ATTTTCCACTTTAGTTTTATTGG + Intergenic
1077714771 11:4569737-4569759 GTTTAACACTTAAGCTGTCTGGG + Intergenic
1078419065 11:11192975-11192997 GTTGTCAACTTAAGCTTTGGGGG - Intergenic
1079768344 11:24424301-24424323 GTTTTCTTGTTGAGCTTTGTGGG - Intergenic
1081259940 11:40947389-40947411 GTCTTGCTTTTAAGCTTTGTTGG + Intronic
1086525934 11:87725949-87725971 CTTTTCCACTTAATAGTTGTTGG - Intergenic
1086996254 11:93359799-93359821 TTTTTCCACTAAGCCTTTGTAGG - Intronic
1090059547 11:123452221-123452243 GTTTTTCCTTTAAGCTCTGTTGG - Intergenic
1091762970 12:3099709-3099731 GGTTTGCTGTTAAGCTTTGTTGG + Intronic
1092044413 12:5419594-5419616 GTTTTCCTTTTAACCTCTGTAGG + Intergenic
1093798379 12:23341264-23341286 CTTTTTGACCTAAGCTTTGTTGG + Intergenic
1095770001 12:45943281-45943303 ATTTTCCACTTAATATTTTTGGG - Intronic
1097442462 12:59627553-59627575 GTCTTCCTCTGAAGCTTTGTGGG - Intronic
1099600810 12:84734933-84734955 GCTGTCCACTTGAGCTTTATTGG - Intergenic
1099817655 12:87669299-87669321 GTGTTCCACTCCAGGTTTGTTGG + Intergenic
1102742426 12:115219923-115219945 GTTTTCCACTAATACGTTGTGGG - Intergenic
1103984542 12:124758566-124758588 GTTTTCCACTGATGCGTTGAAGG - Intergenic
1107292443 13:38870892-38870914 GATTTCCAATTAAGCTTTATAGG - Intronic
1108376656 13:49820162-49820184 GTTTTCCACCTAATCTATCTAGG - Intergenic
1109701571 13:66032507-66032529 TTTTTCCTCTTAAGATTTATAGG + Intergenic
1109987419 13:70007645-70007667 GGTATCTATTTAAGCTTTGTTGG + Intronic
1112172878 13:96992718-96992740 GTTTTGCAGATCAGCTTTGTTGG + Intronic
1115782896 14:36790067-36790089 GCTTTCAACTTGAGGTTTGTAGG + Intronic
1118630199 14:67695540-67695562 GTTTTCCAAGAAAGCTTTGGTGG + Intronic
1119109784 14:71960692-71960714 GTCTCCCACTTAATCTTTCTGGG + Intronic
1120193355 14:81459468-81459490 TTTATCCACTGAAGATTTGTTGG + Intergenic
1124569422 15:30848518-30848540 GTCTTGCTTTTAAGCTTTGTTGG - Intergenic
1125866654 15:43057075-43057097 GGTTACCCCTTAAACTTTGTAGG - Intronic
1129549552 15:76432899-76432921 ATTTCTAACTTAAGCTTTGTAGG - Intronic
1133079466 16:3306896-3306918 GTTTTCCATTTAATATTTTTTGG - Intronic
1134354778 16:13471510-13471532 TTTTTCCACTTCAGCTTGGAAGG - Intergenic
1136395471 16:29990410-29990432 TTTTTCCACTTAATATTTCTTGG + Intronic
1137859405 16:51831110-51831132 GTTTTCCAGTTTAGCCTTGATGG + Intergenic
1139754025 16:69128500-69128522 GTTTTCTACTTGATCTTTATGGG + Intronic
1140340523 16:74155037-74155059 CTTTTCCTCTTGATCTTTGTTGG + Intergenic
1140945078 16:79760504-79760526 TTGTTCCACTCAAGCTTTCTGGG + Intergenic
1142624096 17:1181053-1181075 GTTTTCCCCTTAAGCTGCCTGGG - Intronic
1143957560 17:10684544-10684566 GTTTTCAATTTAAGTTTTGCAGG + Intronic
1143964039 17:10743546-10743568 GTTTGCCAATAAAGGTTTGTAGG + Intergenic
1145871596 17:28277998-28278020 TTTTTCCACTTAAGTTTTAAGGG - Intergenic
1148264312 17:46213021-46213043 GTTTTCCACAGAAAGTTTGTCGG - Intronic
1150867527 17:68869478-68869500 TTTTTTCACTTTTGCTTTGTGGG - Intronic
1151691452 17:75688579-75688601 GTTTGACACTGGAGCTTTGTGGG + Intronic
1152402780 17:80078395-80078417 GTTTTCCACTAAAGTTTTCCAGG + Intronic
1155838500 18:30617745-30617767 TTTTTTCACTTAAGCTTTGAAGG - Intergenic
1157946256 18:51984129-51984151 GTTTTCAACTTGAGTTTTGGAGG + Intergenic
1158466218 18:57692374-57692396 GTTTTCCAGTTCAGCCTTGTTGG - Intronic
1160671764 19:368420-368442 GTCTCCCACTTATGCTTTGCTGG + Intronic
1165619415 19:37232635-37232657 GTATTCCACTTAATCTATGAAGG - Intronic
1165912052 19:39235578-39235600 GGTTTCCACATGAGCTTTGGAGG - Intergenic
930110249 2:47672798-47672820 TTTTTCCTCTTAAGCTTTACAGG - Intergenic
931740836 2:65242093-65242115 GTTTTCCACTTTTGCTTGATGGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
937558477 2:123190293-123190315 GTTATCCTCTCAAGCTTTCTTGG - Intergenic
940224577 2:151388201-151388223 TTTCTGCACTTACGCTTTGTGGG - Intergenic
940382483 2:153031922-153031944 ATTTCCCAGTTGAGCTTTGTTGG + Intergenic
940892972 2:159053262-159053284 TTTTTTCCCTTAAGCTCTGTTGG - Intronic
941904295 2:170706128-170706150 GTTTTTCATTAAATCTTTGTTGG + Intergenic
943954222 2:194165416-194165438 GTTGCCCAGTTAAGGTTTGTGGG - Intergenic
944945835 2:204683814-204683836 GTTTTTCACTTAAAATTTTTGGG + Intronic
947078602 2:226370570-226370592 TTTATCCACTAAAACTTTGTTGG + Intergenic
1170447553 20:16444442-16444464 GTATTCCAATAAAGCTTTATGGG - Intronic
1174747862 20:53081775-53081797 ATTTTCCCCGTAAGCTCTGTGGG + Intronic
1174888772 20:54366522-54366544 GTTTTCAACTTTAGCTTTATTGG - Intergenic
1176229243 20:64023250-64023272 ATTTTCCATTTAAGCTGTGCTGG + Intronic
1178820279 21:35968523-35968545 GTTTTCTACATCAGCTTTATTGG - Intronic
1180863086 22:19098484-19098506 GTTTTTCGCTAAAGCTTTATTGG - Intronic
1181133593 22:20749038-20749060 TTTGTCCACTTAAACTTTCTAGG + Intronic
1181487506 22:23241064-23241086 GTTTTCCACTCATGCATTGATGG + Intronic
1183608343 22:38880270-38880292 ATTTTCCAATTAATATTTGTTGG + Intergenic
1183656989 22:39191926-39191948 GTTCTCCACTTGGCCTTTGTTGG - Intergenic
1184076099 22:42179358-42179380 TTTTTCCCTTTAAGCTCTGTTGG - Intronic
949664566 3:6322269-6322291 ATTTTCCATTTAAGATTTCTGGG + Intergenic
949804957 3:7944636-7944658 GGCTTGCATTTAAGCTTTGTTGG + Intergenic
950618520 3:14182344-14182366 TTTTTTCACTTAATCTTTCTTGG + Intronic
951422330 3:22502076-22502098 GTGTTCCACTTAAGATATATAGG + Intergenic
952231770 3:31438514-31438536 TTTTTCCATTTAAACTTTCTTGG - Intergenic
952291802 3:32023973-32023995 ATTTTCCACTTAATATTTTTGGG + Intronic
953093563 3:39753249-39753271 GTTTTCCACTTAAGAGATGTTGG + Intergenic
955666518 3:61355131-61355153 GCTTCCCACTCAAGCTTTGCTGG + Intergenic
955865784 3:63382396-63382418 GTTTCCCACTTGACCTTTGCTGG + Intronic
955987123 3:64585172-64585194 GTTTTTCACTTAAAATGTGTTGG + Intronic
958264426 3:91421317-91421339 ATTGCCCACTTAATCTTTGTTGG + Intergenic
963307967 3:143675171-143675193 GGTGGCCACTTAAGCTTTCTAGG - Intronic
965612671 3:170561358-170561380 GTTTTCCACTTAAACTGCTTTGG + Intronic
966360597 3:179125293-179125315 ATTTTCCACTTAAAATTTGTAGG + Intergenic
967570620 3:191024093-191024115 GTTTTCCATCCAAGCTTTGAGGG + Intergenic
968400345 4:290146-290168 ATTTTCTACTTATGTTTTGTAGG - Intronic
970657256 4:18245287-18245309 GTAGTGCACTTAACCTTTGTGGG + Intergenic
971049144 4:22840883-22840905 GGTTTTCCCTTAAGCTTTGGGGG + Intergenic
971789059 4:31143447-31143469 GTTTTTCTCTTAGTCTTTGTTGG - Intronic
972405739 4:38744863-38744885 ATTTTCCACTTAATATTTTTGGG + Intergenic
973164761 4:47063466-47063488 ACTTTTTACTTAAGCTTTGTTGG - Intronic
975618690 4:76274267-76274289 GTTTTGCTTTTAAGATTTGTTGG + Intronic
976486818 4:85615759-85615781 GATTTCCACTTATCCCTTGTGGG - Intronic
976978861 4:91199023-91199045 TTTTTCAACTTAAACTTTGTAGG - Intronic
977571021 4:98630115-98630137 GGTTACCACTTAATCCTTGTTGG - Intronic
978840209 4:113203200-113203222 GATTTCCATTTAAGCTGTATGGG + Intronic
979871108 4:125823143-125823165 GTCTTGCATTTAAGCTTTGTTGG - Intergenic
979881736 4:125968514-125968536 TTTTTCCCCTTAATCTTTCTAGG + Intergenic
981880056 4:149599497-149599519 TTCTACCCCTTAAGCTTTGTGGG + Intergenic
983709805 4:170699890-170699912 GTTTTCCATTTTAGATATGTAGG - Intergenic
987639013 5:20587239-20587261 ATTTTCCACTGTAGCTTTGTAGG - Intergenic
989955760 5:50357941-50357963 GTTTTTTACTTGAGATTTGTGGG + Intergenic
990870041 5:60421249-60421271 GTCTCCCAGTTAAGCTATGTGGG - Intronic
994327765 5:98468894-98468916 GTTTTCAGCTTGAGCATTGTTGG - Intergenic
994687620 5:102975291-102975313 GTTTTCAAATTCAGCTTTGTAGG + Intronic
995322028 5:110845757-110845779 TTTCTCCACTAAAGCTGTGTTGG + Intergenic
995827797 5:116320497-116320519 GTGTTCTGCTTAAGCTTTTTAGG + Intronic
995881936 5:116852935-116852957 GTTTTGCTTTTAAGATTTGTTGG - Intergenic
1000893198 5:166824317-166824339 GTCTTCCACTTCAGCGCTGTGGG - Intergenic
1003997709 6:11559711-11559733 GTTCTACACTTCAGATTTGTTGG + Intronic
1004561552 6:16757640-16757662 ATTTACCAGTTTAGCTTTGTTGG + Intronic
1004684815 6:17932981-17933003 TTTTTCTAATTAAGCTTTTTGGG - Intronic
1007584384 6:42979837-42979859 GTCTTCAACTTAAGTTTGGTGGG - Intergenic
1008991018 6:57601665-57601687 ATTGCCCACTTAATCTTTGTTGG - Intronic
1009179537 6:60499905-60499927 ATTGCCCACTTAATCTTTGTTGG - Intergenic
1013417217 6:109935818-109935840 GTATGCCACTGAAGTTTTGTGGG - Intergenic
1013694114 6:112681120-112681142 GTTTTCCAAGTAAGCTTATTTGG + Intergenic
1014034817 6:116754032-116754054 ATTTTTCACTTACCCTTTGTTGG - Intronic
1014819406 6:125970391-125970413 GTTTCACACTTTAGCTTTTTAGG + Intronic
1017944675 6:159085666-159085688 TTTCTCCACTTAACCTTAGTGGG + Intergenic
1018309136 6:162490744-162490766 TCTTTCCATTTAAACTTTGTAGG - Intronic
1021278820 7:18690941-18690963 GTTTTCCACTAAGGGATTGTAGG + Intronic
1025824828 7:65002051-65002073 TTTTTCCACTTGAGTTTTCTGGG - Intronic
1028117046 7:87010123-87010145 GTTGTAGACTGAAGCTTTGTAGG - Intronic
1028477832 7:91270302-91270324 GTTTTCCACTTAAGCTTTGTGGG + Exonic
1028763298 7:94520427-94520449 TTTTTCAAATTATGCTTTGTGGG + Intronic
1028827701 7:95292777-95292799 GTTTACATCTTATGCTTTGTGGG - Intronic
1029027678 7:97434476-97434498 GATTAGCACTTAAGCATTGTGGG + Intergenic
1030066927 7:105666906-105666928 GTTTACCACTTAAACTTCCTTGG + Intronic
1030615150 7:111730956-111730978 TTTTTCAACTTAAATTTTGTTGG - Intronic
1030962486 7:115944308-115944330 GTTGTCCTCTTTAGCTTTCTTGG - Intronic
1031898044 7:127376274-127376296 TTTTTCAACTTAACCTTTTTGGG - Intronic
1031919925 7:127593037-127593059 GTTTTCTCCTCAAGCTTTGCAGG + Intronic
1032769927 7:135041575-135041597 GTTTTACATTTAAGGTTTGAGGG - Intronic
1035660141 8:1341608-1341630 GTTTTCCCCATAATCTTTGCAGG + Intergenic
1038898335 8:31812751-31812773 GTTATCCATTTAAGCTTAGAAGG + Intronic
1040127958 8:43760156-43760178 TTTTTCCTCTTAAGCCTTGATGG - Intergenic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1040785757 8:51160249-51160271 GTTTTCCACCTAAGCTTGTCAGG - Intergenic
1041204459 8:55484218-55484240 ATTTTCCAGTAAAGCTTTCTTGG - Intronic
1041267129 8:56076036-56076058 GTTTTCCAGTTCAGTTTTTTGGG + Intergenic
1044369783 8:91395849-91395871 GTTTTCCACTGAAGCTTTGTTGG + Intronic
1044979852 8:97705670-97705692 ATTTTTCATTTAAGCATTGTTGG + Intronic
1044997552 8:97851627-97851649 GTTTTCAACATATGCTTTGCTGG + Exonic
1045109073 8:98922078-98922100 GTTTCCCTCTTAAGCCTTATTGG - Intronic
1048750682 8:137670231-137670253 GTTTTCCACTTGGCCTTTATTGG - Intergenic
1048928092 8:139288880-139288902 CTTTTCCACTTAAGCATCTTGGG + Intergenic
1051446551 9:17145885-17145907 CTTTTGCCCTTAAGCTTAGTTGG + Intronic
1052030492 9:23622607-23622629 GTCTTCCACCTAAGCATTCTGGG - Intergenic
1052762664 9:32608722-32608744 GTTTTCCATTTTAACTTTGAAGG - Intergenic
1057449195 9:95141791-95141813 GTTTTCTTATTAAGCATTGTTGG + Intronic
1058776444 9:108288785-108288807 GTTTTCCACTAAACTTTTCTTGG - Intergenic
1186115405 X:6300407-6300429 GTTTTTCACGTATGCTCTGTTGG + Intergenic
1186609164 X:11122019-11122041 GCTTCCCACTTAAGCTAAGTAGG - Exonic
1186939713 X:14492194-14492216 TTTGTCCACTTGAGTTTTGTAGG + Intergenic
1189921155 X:45904245-45904267 GTTTTCCAGTTCCACTTTGTAGG - Intergenic
1192094074 X:68191871-68191893 GTCTTCTTTTTAAGCTTTGTTGG - Intronic
1194492370 X:94567888-94567910 GTTTTTCACTTCAGGTTAGTGGG + Intergenic
1194546979 X:95248385-95248407 GCTCTCCACTTGACCTTTGTTGG + Intergenic
1195496482 X:105541237-105541259 TTCATCCACTTACGCTTTGTGGG - Intronic
1196575368 X:117311830-117311852 GTTTGCAACTCAAGCTTTTTAGG - Intergenic
1198623332 X:138538798-138538820 ATATTACACTTAAGCTTTGTAGG + Intergenic
1199729475 X:150617075-150617097 CTTTTCTACTTCAGTTTTGTTGG + Intronic
1201516184 Y:14820546-14820568 GTTTTCACCTGAAGCTTTGTTGG - Intronic