ID: 1028482485

View in Genome Browser
Species Human (GRCh38)
Location 7:91322763-91322785
Sequence CTGGGTCATCACTCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028482480_1028482485 13 Left 1028482480 7:91322727-91322749 CCTGTGGTTTTTTACTCTTTATT No data
Right 1028482485 7:91322763-91322785 CTGGGTCATCACTCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028482485 Original CRISPR CTGGGTCATCACTCTCAGGA AGG Intergenic
No off target data available for this crispr