ID: 1028485336

View in Genome Browser
Species Human (GRCh38)
Location 7:91351223-91351245
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028485335_1028485336 -10 Left 1028485335 7:91351210-91351232 CCATTCATTAATGCTAAATGCTT No data
Right 1028485336 7:91351223-91351245 CTAAATGCTTTATGTGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028485336 Original CRISPR CTAAATGCTTTATGTGTAAT AGG Intergenic
No off target data available for this crispr