ID: 1028488005

View in Genome Browser
Species Human (GRCh38)
Location 7:91381124-91381146
Sequence TTGGATTTGAATAAAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028488005_1028488010 26 Left 1028488005 7:91381124-91381146 CCATTCTCTTTATTCAAATCCAA No data
Right 1028488010 7:91381173-91381195 GAATTGACTTTCATATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028488005 Original CRISPR TTGGATTTGAATAAAGAGAA TGG (reversed) Intergenic
No off target data available for this crispr