ID: 1028492293

View in Genome Browser
Species Human (GRCh38)
Location 7:91425596-91425618
Sequence GTGTGGGAAGTCAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028492293_1028492302 19 Left 1028492293 7:91425596-91425618 CCCACTTCCCTGACTTCCCACAC No data
Right 1028492302 7:91425638-91425660 TCCCTCCATTAGACCAGCCTTGG No data
1028492293_1028492306 21 Left 1028492293 7:91425596-91425618 CCCACTTCCCTGACTTCCCACAC No data
Right 1028492306 7:91425640-91425662 CCTCCATTAGACCAGCCTTGGGG No data
1028492293_1028492307 22 Left 1028492293 7:91425596-91425618 CCCACTTCCCTGACTTCCCACAC No data
Right 1028492307 7:91425641-91425663 CTCCATTAGACCAGCCTTGGGGG No data
1028492293_1028492304 20 Left 1028492293 7:91425596-91425618 CCCACTTCCCTGACTTCCCACAC No data
Right 1028492304 7:91425639-91425661 CCCTCCATTAGACCAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028492293 Original CRISPR GTGTGGGAAGTCAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr