ID: 1028492461

View in Genome Browser
Species Human (GRCh38)
Location 7:91427328-91427350
Sequence GAGCACTGATGGAAGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028492461_1028492464 -1 Left 1028492461 7:91427328-91427350 CCAGCAGTCTTCCATCAGTGCTC No data
Right 1028492464 7:91427350-91427372 CCTACCAGTGCTACCAATCTAGG No data
1028492461_1028492466 11 Left 1028492461 7:91427328-91427350 CCAGCAGTCTTCCATCAGTGCTC No data
Right 1028492466 7:91427362-91427384 ACCAATCTAGGTAGATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028492461 Original CRISPR GAGCACTGATGGAAGACTGC TGG (reversed) Intergenic
No off target data available for this crispr