ID: 1028504024

View in Genome Browser
Species Human (GRCh38)
Location 7:91551977-91551999
Sequence CAAGAGAAACAGGTTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028504024_1028504026 -3 Left 1028504024 7:91551977-91551999 CCTGTAGAAACCTGTTTCTCTTG No data
Right 1028504026 7:91551997-91552019 TTGAGATCTGACTTCTCTACTGG No data
1028504024_1028504028 15 Left 1028504024 7:91551977-91551999 CCTGTAGAAACCTGTTTCTCTTG No data
Right 1028504028 7:91552015-91552037 ACTGGGAGCTCAGAGACGATAGG No data
1028504024_1028504027 -2 Left 1028504024 7:91551977-91551999 CCTGTAGAAACCTGTTTCTCTTG No data
Right 1028504027 7:91551998-91552020 TGAGATCTGACTTCTCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028504024 Original CRISPR CAAGAGAAACAGGTTTCTAC AGG (reversed) Intergenic