ID: 1028505504

View in Genome Browser
Species Human (GRCh38)
Location 7:91566075-91566097
Sequence CGGTGTATGAGGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028505504_1028505513 19 Left 1028505504 7:91566075-91566097 CCTTCCACTTTCCTCATACACCG No data
Right 1028505513 7:91566117-91566139 CTGCCAAGCCCTGACAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028505504 Original CRISPR CGGTGTATGAGGAAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr