ID: 1028506621

View in Genome Browser
Species Human (GRCh38)
Location 7:91578655-91578677
Sequence CTGTGTCAGATGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028506621_1028506628 4 Left 1028506621 7:91578655-91578677 CCCTCCAGCTTCATCTGACACAG No data
Right 1028506628 7:91578682-91578704 GGGCCTCCTCCAAACACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028506621 Original CRISPR CTGTGTCAGATGAAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr