ID: 1028509451

View in Genome Browser
Species Human (GRCh38)
Location 7:91607741-91607763
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028509451_1028509456 21 Left 1028509451 7:91607741-91607763 CCAGCAACCAACTCCTTAACAGG No data
Right 1028509456 7:91607785-91607807 TTCACTCCATTCCTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028509451 Original CRISPR CCTGTTAAGGAGTTGGTTGC TGG (reversed) Intergenic
No off target data available for this crispr