ID: 1028510522

View in Genome Browser
Species Human (GRCh38)
Location 7:91620532-91620554
Sequence CAGTATACCCACCTTTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028510522_1028510524 -5 Left 1028510522 7:91620532-91620554 CCCAGTTAAAGGTGGGTATACTG No data
Right 1028510524 7:91620550-91620572 TACTGCAATCTCCTTCAAGATGG No data
1028510522_1028510526 25 Left 1028510522 7:91620532-91620554 CCCAGTTAAAGGTGGGTATACTG No data
Right 1028510526 7:91620580-91620602 TCGCTCTGTTAATTACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028510522 Original CRISPR CAGTATACCCACCTTTAACT GGG (reversed) Intergenic
No off target data available for this crispr