ID: 1028511010

View in Genome Browser
Species Human (GRCh38)
Location 7:91626416-91626438
Sequence AAGGACCATGTTCTTGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511010_1028511021 25 Left 1028511010 7:91626416-91626438 CCATTCCCAAGAACATGGTCCTT No data
Right 1028511021 7:91626464-91626486 ACATCCACACTCCAGGCAGCAGG No data
1028511010_1028511022 26 Left 1028511010 7:91626416-91626438 CCATTCCCAAGAACATGGTCCTT No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511010_1028511019 18 Left 1028511010 7:91626416-91626438 CCATTCCCAAGAACATGGTCCTT No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511010 Original CRISPR AAGGACCATGTTCTTGGGAA TGG (reversed) Intergenic
No off target data available for this crispr