ID: 1028511011

View in Genome Browser
Species Human (GRCh38)
Location 7:91626421-91626443
Sequence CTATCAAGGACCATGTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511011_1028511022 21 Left 1028511011 7:91626421-91626443 CCCAAGAACATGGTCCTTGATAG No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511011_1028511021 20 Left 1028511011 7:91626421-91626443 CCCAAGAACATGGTCCTTGATAG No data
Right 1028511021 7:91626464-91626486 ACATCCACACTCCAGGCAGCAGG No data
1028511011_1028511019 13 Left 1028511011 7:91626421-91626443 CCCAAGAACATGGTCCTTGATAG No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511011 Original CRISPR CTATCAAGGACCATGTTCTT GGG (reversed) Intergenic
No off target data available for this crispr