ID: 1028511016

View in Genome Browser
Species Human (GRCh38)
Location 7:91626435-91626457
Sequence TGGAGCTCCCAGGCCTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511016_1028511025 30 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511016_1028511021 6 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511021 7:91626464-91626486 ACATCCACACTCCAGGCAGCAGG No data
1028511016_1028511019 -1 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data
1028511016_1028511022 7 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511016 Original CRISPR TGGAGCTCCCAGGCCTATCA AGG (reversed) Intergenic