ID: 1028511017

View in Genome Browser
Species Human (GRCh38)
Location 7:91626445-91626467
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511017_1028511022 -3 Left 1028511017 7:91626445-91626467 CCTGGGAGCTCCAGCCATTACAT No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511017_1028511025 20 Left 1028511017 7:91626445-91626467 CCTGGGAGCTCCAGCCATTACAT No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511017_1028511021 -4 Left 1028511017 7:91626445-91626467 CCTGGGAGCTCCAGCCATTACAT No data
Right 1028511021 7:91626464-91626486 ACATCCACACTCCAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511017 Original CRISPR ATGTAATGGCTGGAGCTCCC AGG (reversed) Intergenic
No off target data available for this crispr