ID: 1028511019

View in Genome Browser
Species Human (GRCh38)
Location 7:91626457-91626479
Sequence AGCCATTACATCCACACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511010_1028511019 18 Left 1028511010 7:91626416-91626438 CCATTCCCAAGAACATGGTCCTT No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data
1028511016_1028511019 -1 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data
1028511011_1028511019 13 Left 1028511011 7:91626421-91626443 CCCAAGAACATGGTCCTTGATAG No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data
1028511012_1028511019 12 Left 1028511012 7:91626422-91626444 CCAAGAACATGGTCCTTGATAGG No data
Right 1028511019 7:91626457-91626479 AGCCATTACATCCACACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511019 Original CRISPR AGCCATTACATCCACACTCC AGG Intergenic
No off target data available for this crispr