ID: 1028511022

View in Genome Browser
Species Human (GRCh38)
Location 7:91626465-91626487
Sequence CATCCACACTCCAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511016_1028511022 7 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511017_1028511022 -3 Left 1028511017 7:91626445-91626467 CCTGGGAGCTCCAGCCATTACAT No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511010_1028511022 26 Left 1028511010 7:91626416-91626438 CCATTCCCAAGAACATGGTCCTT No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511011_1028511022 21 Left 1028511011 7:91626421-91626443 CCCAAGAACATGGTCCTTGATAG No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data
1028511012_1028511022 20 Left 1028511012 7:91626422-91626444 CCAAGAACATGGTCCTTGATAGG No data
Right 1028511022 7:91626465-91626487 CATCCACACTCCAGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511022 Original CRISPR CATCCACACTCCAGGCAGCA GGG Intergenic
No off target data available for this crispr