ID: 1028511025

View in Genome Browser
Species Human (GRCh38)
Location 7:91626488-91626510
Sequence TGTAAGAAAGCAGAGAAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028511023_1028511025 -3 Left 1028511023 7:91626468-91626490 CCACACTCCAGGCAGCAGGGTGT No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511018_1028511025 10 Left 1028511018 7:91626455-91626477 CCAGCCATTACATCCACACTCCA No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511020_1028511025 6 Left 1028511020 7:91626459-91626481 CCATTACATCCACACTCCAGGCA No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511016_1028511025 30 Left 1028511016 7:91626435-91626457 CCTTGATAGGCCTGGGAGCTCCA No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511017_1028511025 20 Left 1028511017 7:91626445-91626467 CCTGGGAGCTCCAGCCATTACAT No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data
1028511024_1028511025 -10 Left 1028511024 7:91626475-91626497 CCAGGCAGCAGGGTGTAAGAAAG No data
Right 1028511025 7:91626488-91626510 TGTAAGAAAGCAGAGAAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028511025 Original CRISPR TGTAAGAAAGCAGAGAAGAA CGG Intergenic
No off target data available for this crispr