ID: 1028514021

View in Genome Browser
Species Human (GRCh38)
Location 7:91656697-91656719
Sequence CTTTCCTAGTGTTGCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028514021_1028514033 28 Left 1028514021 7:91656697-91656719 CCAGTGTGGCAACACTAGGAAAG No data
Right 1028514033 7:91656748-91656770 CCCTCTGCCGAACAGCGCCGTGG No data
1028514021_1028514026 -8 Left 1028514021 7:91656697-91656719 CCAGTGTGGCAACACTAGGAAAG No data
Right 1028514026 7:91656712-91656734 TAGGAAAGGGTCGGGCCTTCTGG No data
1028514021_1028514035 29 Left 1028514021 7:91656697-91656719 CCAGTGTGGCAACACTAGGAAAG No data
Right 1028514035 7:91656749-91656771 CCTCTGCCGAACAGCGCCGTGGG No data
1028514021_1028514036 30 Left 1028514021 7:91656697-91656719 CCAGTGTGGCAACACTAGGAAAG No data
Right 1028514036 7:91656750-91656772 CTCTGCCGAACAGCGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028514021 Original CRISPR CTTTCCTAGTGTTGCCACAC TGG (reversed) Intergenic
No off target data available for this crispr