ID: 1028514027

View in Genome Browser
Species Human (GRCh38)
Location 7:91656727-91656749
Sequence GGGCTGTGGTGGGAGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028514027_1028514033 -2 Left 1028514027 7:91656727-91656749 CCTTCTGGCTCCCACCACAGCCC No data
Right 1028514033 7:91656748-91656770 CCCTCTGCCGAACAGCGCCGTGG No data
1028514027_1028514035 -1 Left 1028514027 7:91656727-91656749 CCTTCTGGCTCCCACCACAGCCC No data
Right 1028514035 7:91656749-91656771 CCTCTGCCGAACAGCGCCGTGGG No data
1028514027_1028514036 0 Left 1028514027 7:91656727-91656749 CCTTCTGGCTCCCACCACAGCCC No data
Right 1028514036 7:91656750-91656772 CTCTGCCGAACAGCGCCGTGGGG No data
1028514027_1028514038 14 Left 1028514027 7:91656727-91656749 CCTTCTGGCTCCCACCACAGCCC No data
Right 1028514038 7:91656764-91656786 GCCGTGGGGCCACCTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028514027 Original CRISPR GGGCTGTGGTGGGAGCCAGA AGG (reversed) Intergenic
No off target data available for this crispr