ID: 1028514035

View in Genome Browser
Species Human (GRCh38)
Location 7:91656749-91656771
Sequence CCTCTGCCGAACAGCGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028514027_1028514035 -1 Left 1028514027 7:91656727-91656749 CCTTCTGGCTCCCACCACAGCCC No data
Right 1028514035 7:91656749-91656771 CCTCTGCCGAACAGCGCCGTGGG No data
1028514021_1028514035 29 Left 1028514021 7:91656697-91656719 CCAGTGTGGCAACACTAGGAAAG No data
Right 1028514035 7:91656749-91656771 CCTCTGCCGAACAGCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028514035 Original CRISPR CCTCTGCCGAACAGCGCCGT GGG Intergenic
No off target data available for this crispr