ID: 1028516481

View in Genome Browser
Species Human (GRCh38)
Location 7:91682761-91682783
Sequence GAGAGTGGCAAGCCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028516474_1028516481 21 Left 1028516474 7:91682717-91682739 CCACAAAAAAAGAGAGAGAGAGT No data
Right 1028516481 7:91682761-91682783 GAGAGTGGCAAGCCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028516481 Original CRISPR GAGAGTGGCAAGCCTGGGGA GGG Intergenic
No off target data available for this crispr