ID: 1028517822

View in Genome Browser
Species Human (GRCh38)
Location 7:91697823-91697845
Sequence GGTCCCTGGAAGCACCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028517822_1028517827 19 Left 1028517822 7:91697823-91697845 CCTTCATGGTGCTTCCAGGGACC 0: 1
1: 0
2: 4
3: 19
4: 197
Right 1028517827 7:91697865-91697887 TGCCCCCAAATCCTTGTTTCAGG No data
1028517822_1028517828 20 Left 1028517822 7:91697823-91697845 CCTTCATGGTGCTTCCAGGGACC 0: 1
1: 0
2: 4
3: 19
4: 197
Right 1028517828 7:91697866-91697888 GCCCCCAAATCCTTGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028517822 Original CRISPR GGTCCCTGGAAGCACCATGA AGG (reversed) Intronic
900569327 1:3350655-3350677 GGGCCCTGGGAGCACCCAGAAGG + Intronic
901511001 1:9717980-9718002 GCTCCCTGGAGGCACCAGGGCGG + Intronic
902113530 1:14102643-14102665 GGGCCCTGAAGGCACCAGGATGG - Intergenic
902698849 1:18158026-18158048 GGTCCCTGGGGACACTATGAAGG + Intronic
902767139 1:18624797-18624819 TGTCCCTTGGAGCACCACGAGGG - Intergenic
903446876 1:23428100-23428122 GATCCCAGGAAGCATAATGAGGG - Intergenic
903869783 1:26425590-26425612 GGTCCCTGGCAGCATCTGGAAGG + Intronic
905915292 1:41680124-41680146 GGTCCCTGGGATGACCATGTGGG + Intronic
906545554 1:46617021-46617043 GGTCCAAGGAAGCACCGAGAGGG - Intergenic
906644200 1:47461806-47461828 TGTGCCTGGAAGCAGCAGGAGGG + Intergenic
906665411 1:47617860-47617882 GGGCTCTAGAAACACCATGATGG - Intergenic
906709160 1:47916331-47916353 GAGCCCTGGAAGCACAAAGATGG + Intronic
906848637 1:49223218-49223240 GGTACCTGGAAATACCAAGATGG + Intronic
909061352 1:70882388-70882410 TGTCCCAGGAAGCACCCAGATGG - Intronic
910934511 1:92476380-92476402 AGTCCCTGGAAGCACCATGGGGG + Intronic
911179290 1:94847033-94847055 GCTCCCTGGAAGCTCGCTGAAGG + Intronic
912499370 1:110111916-110111938 GATCCCAGGAGGCACCAGGAGGG - Intergenic
913490150 1:119371834-119371856 GAGCCCTGGAGGCAGCATGATGG - Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
918927642 1:190809063-190809085 GGTGCCAGGCAGCCCCATGAAGG - Intergenic
921493585 1:215809057-215809079 GGTCTCTGGTAGCATCATCATGG - Intronic
922164443 1:223103227-223103249 GGTCACTGGAAAAACCATGAAGG + Intergenic
923832106 1:237569847-237569869 GCTCTGTGGAAGCACCATGCAGG + Intronic
1063520128 10:6733960-6733982 GGTCCCTTGAAGAATCTTGATGG - Intergenic
1064878493 10:20022474-20022496 GGTCCTTGAAAGCCACATGAGGG + Intronic
1065268195 10:23999352-23999374 GGACCCTGGCAGCACCAAGTAGG + Intronic
1067799980 10:49352220-49352242 GGTCACAGGAAGGACCCTGATGG + Intergenic
1070509217 10:77145175-77145197 GGTCCCTGGAACCAGCAGCAGGG + Intronic
1070654258 10:78260512-78260534 TGTCCCTGGAAGGATTATGAGGG + Intergenic
1073520183 10:104121495-104121517 GGTCTCTGGAACCACCACGCTGG + Intergenic
1074371165 10:112901695-112901717 GATCCCAGGAAGCACCAGTAAGG - Intergenic
1074442575 10:113491694-113491716 GATCCCAGGAAGCATGATGAGGG - Intergenic
1074975705 10:118579915-118579937 GGTCCTCAGAAGGACCATGAGGG - Intergenic
1076246324 10:128950205-128950227 GTACCCTGGAGGCACCAGGAGGG + Intergenic
1076798759 10:132811174-132811196 GGTCCCTGGAAAAAACCTGACGG - Intronic
1076905438 10:133358529-133358551 GGTCCCTGGGGTCACCATGGTGG + Intergenic
1078367576 11:10719417-10719439 GGCACCTGGAAGCCCCATGGAGG - Intergenic
1079031568 11:16990058-16990080 GGTCCCTGGTGACACCAAGAAGG + Intronic
1082758024 11:57097220-57097242 GTTCCCAGGGACCACCATGAGGG - Intergenic
1084484309 11:69439036-69439058 GGTCCCTGGGAGGACCCTGGGGG - Intergenic
1087256793 11:95965033-95965055 GATACCTGGAAGCACTGTGAAGG + Intergenic
1089703416 11:120259574-120259596 GGACCCAGGAGGCCCCATGAGGG - Intronic
1091302073 11:134514314-134514336 GGTCCCTGGAAGCAGCCTCAGGG + Intergenic
1096544895 12:52331259-52331281 GGTCACTGGAACAGCCATGATGG - Intergenic
1097276379 12:57816169-57816191 GGTGCAGGGATGCACCATGAGGG - Exonic
1099173221 12:79390488-79390510 GGTGCCTGCAAGCACTGTGAGGG - Intronic
1099371014 12:81829804-81829826 GGTCCCTGGATGCACCAGGGAGG + Intergenic
1101434654 12:104654517-104654539 GGTCCCTGGATTCCCCATGGTGG + Intronic
1101513288 12:105411737-105411759 GATCCCAGGATGCACCAGGAGGG + Intergenic
1102414660 12:112750304-112750326 GGTCCCAGGAAACACTAGGAGGG + Intronic
1103848822 12:123917966-123917988 GGTCCCTGGGAACACCTTTAGGG - Intronic
1104063261 12:125285714-125285736 GATCCCTGGTAGCAACATGAGGG + Intronic
1104823670 12:131693474-131693496 GGCCCCTGGAAGACACATGAGGG - Intergenic
1104929513 12:132330155-132330177 GGGCCCTGGAGCCACCAGGAGGG + Intergenic
1107067035 13:36225501-36225523 GGCCCCTGGAAACACCATTCTGG + Intronic
1108941802 13:55964306-55964328 TGTCCCAGGAAACACCAGGATGG + Intergenic
1110349819 13:74494220-74494242 AGTCACTGGTAGCTCCATGAGGG - Intergenic
1112224060 13:97520042-97520064 TGTCCATGGGAGCACCTTGAAGG - Intergenic
1113532621 13:111040035-111040057 GGGCACTGGAAGCACCACTATGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1115439275 14:33413336-33413358 GGTCCCTGGAAGCTGCATGAGGG + Intronic
1119320513 14:73727371-73727393 GGGCCCTGGGAGCAACAGGAGGG - Intronic
1119558367 14:75570532-75570554 GGACACTGTAAGCTCCATGAAGG + Intergenic
1120425396 14:84341406-84341428 GGCCGCTGGAATCACCATGTTGG - Intergenic
1121926254 14:97930031-97930053 GTGGGCTGGAAGCACCATGACGG - Intronic
1122038646 14:98966171-98966193 AGTCCTTGGAAGCACCCAGAAGG + Intergenic
1122764331 14:104055053-104055075 GGTTCTTGGAGGCACCATGGTGG + Intergenic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1123448189 15:20344620-20344642 GCTCCCTGGAAGCACCAATCTGG - Intergenic
1124162259 15:27283185-27283207 GGTCTCTGCCAGCACCATGAAGG + Intronic
1126270629 15:46813135-46813157 GATCTCTGGAAGCACAATGCAGG - Intergenic
1126661653 15:51038833-51038855 AGTCCCTGCATGCACCACGAGGG - Intergenic
1126963959 15:54030145-54030167 GGTCCCTGGAAGCAGGAAGAGGG - Intronic
1127068869 15:55268536-55268558 TGTCCCTGGGAGCACAATCAGGG - Intronic
1128349969 15:66882030-66882052 GGTCCCAGGAAGCCCCAGTAGGG + Intergenic
1128483003 15:68055189-68055211 GGTCTCTGCACACACCATGATGG + Intronic
1130441620 15:83960526-83960548 TGTCCCTTGCAGAACCATGATGG + Intronic
1131178416 15:90224426-90224448 GATGCCAGGAAGCAGCATGAAGG + Intronic
1132225117 15:100134295-100134317 GATCCCAGGAAGCACTGTGAGGG - Intronic
1132593080 16:734943-734965 GTGCCCTGGCAGCACCATGGTGG - Intronic
1134784927 16:16933797-16933819 GATCCCAGGAAGCACCAGTAAGG + Intergenic
1135858912 16:26037293-26037315 AGTCTCTGCAAGCAACATGAAGG - Intronic
1137543206 16:49378553-49378575 GGTCCCTGGCAGCTACATCAAGG + Exonic
1138216607 16:55210356-55210378 GGTCCCAGGAAGTACCAGCAGGG + Intergenic
1139589992 16:67928229-67928251 GCTCCCTGGAGGCACCATGAAGG - Exonic
1140962690 16:79931781-79931803 GGTGGCTGGAAGCAGCATGGAGG - Intergenic
1141859038 16:86704143-86704165 TCTCCCTGGAAGCCCCAAGAGGG + Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1144002251 17:11065957-11065979 GGTCCCTGGAAGCACTGGTAGGG - Intergenic
1146636799 17:34512478-34512500 GCTCCCTGGGAGCACCCTAAAGG + Intergenic
1148700001 17:49581546-49581568 GGCCCCTGGAAGCATGATGTGGG - Intronic
1149507936 17:57211397-57211419 GGTCCCAGGAGGCACCCTCAAGG + Intergenic
1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG + Exonic
1152340606 17:79721962-79721984 GCTCCCTGGAAGCACCAGTCTGG + Intergenic
1152552022 17:81034821-81034843 GGGCCCTGGGAGCAGCCTGAGGG - Intergenic
1153989340 18:10382115-10382137 GGTCGCTGAAAGCGCCATGTAGG - Intergenic
1155929386 18:31689786-31689808 GGTCCCAGGCAGCCCCCTGAAGG + Intergenic
1157003869 18:43559254-43559276 TGTCCCAGGAAGCACCTGGATGG - Intergenic
1157748111 18:50154599-50154621 ATTATCTGGAAGCACCATGAGGG + Intronic
1159305956 18:66642356-66642378 GCTCCCTGGAAGACCCATAAAGG + Intergenic
1160033436 18:75281501-75281523 AGGCCCTGAAAGCACCATGGGGG + Intronic
1160346701 18:78138083-78138105 GGGCCCTGGACACACCATCATGG - Intergenic
1160506301 18:79428439-79428461 GCTCCCTGGAGGCACCACAAAGG - Intronic
1160924201 19:1535275-1535297 GGTCCCTGGCACTACCATGCAGG - Exonic
1162043566 19:7984712-7984734 GGTGCCTGGAGGCAGCAGGAAGG + Intronic
1162823443 19:13236871-13236893 GGTCCCTTGAAGCCCCACAATGG - Intronic
1162842254 19:13365066-13365088 GATCCCAGGAAGCACCATCGGGG - Intronic
1163174866 19:15557153-15557175 GATCCCTGGAAACACAATTAGGG - Intergenic
1165781927 19:38439817-38439839 GGATCCTGGAAGTACCATAAAGG - Intronic
1165796347 19:38522096-38522118 GGTCCCTGGAAGTACTATCATGG - Intronic
1166348063 19:42179179-42179201 GGTCCAGGGAAGCACCAAGGGGG + Intronic
925892926 2:8450581-8450603 GGTCGCAGGGAGCACCAAGAGGG + Intergenic
928049034 2:27969325-27969347 GATCTCTGGAAGCACAGTGAGGG + Intronic
931258919 2:60599795-60599817 GGTCTATGGGAGCACCAGGAGGG + Intergenic
932401522 2:71483854-71483876 GGCTCCTGGAAGCCCCAGGATGG + Intronic
933817209 2:86077650-86077672 GGTGACTGGAAGCTGCATGATGG - Intronic
935284439 2:101551455-101551477 GCTTCCTGGATGCAACATGAGGG + Intergenic
938144502 2:128822332-128822354 TGCCCCTGGCAGCACCAGGAGGG - Intergenic
938585224 2:132683800-132683822 GTCACCTGGAAGCACCAAGATGG - Intronic
939225848 2:139363238-139363260 GGTCTCTGGAAGCACAAGGAAGG + Intergenic
943724397 2:191238081-191238103 GGAGCCTGGAAGCAGCATCAGGG + Intergenic
945440983 2:209879284-209879306 GGCCCCTGGAAGTTCCAGGATGG - Intronic
946014403 2:216592406-216592428 GATCCCTGAAAGCACCACAAAGG + Intergenic
1170334077 20:15248940-15248962 TTTCCCAGGAAGCTCCATGAGGG + Intronic
1171189097 20:23145689-23145711 GGTCACTGGGAGCACCCTGGTGG + Intergenic
1171380764 20:24732311-24732333 GGTCACTGCAAGCATGATGATGG + Intergenic
1173177838 20:40777860-40777882 GGTCCCAGGAAGCACCAGTAGGG + Intergenic
1173869032 20:46330366-46330388 GGGCCCGGGAAGGACCCTGATGG - Intergenic
1173894390 20:46539296-46539318 GATTCCTGGAAGCACCAGTAGGG - Intergenic
1174193706 20:48758096-48758118 GGTCCCTGGAAACACCAACAGGG + Intronic
1174324594 20:49769116-49769138 GATCCCAGAAAGCACCATTAGGG + Intergenic
1175024933 20:55891721-55891743 GGGTCCTGCAAGCCCCATGAGGG + Intergenic
1175965391 20:62657685-62657707 TTTCCCTGAAAGCACCATGTTGG + Intronic
1176059624 20:63166798-63166820 GGCACCTGGATGCACCAGGAGGG + Intergenic
1177252308 21:18610121-18610143 GGTCACTGGAAACATGATGAAGG + Intergenic
1180089838 21:45528256-45528278 TGTCCTTGGAAGCACCCTGGGGG - Intronic
1180285433 22:10741476-10741498 GGTCCCTCGAACCCCCCTGACGG - Intergenic
1181282551 22:21730231-21730253 AGACTCTGGAAGCCCCATGATGG - Intronic
1182004364 22:26946985-26947007 GGTCCCAGGAAACACCAGAAAGG - Intergenic
1182557865 22:31138784-31138806 GGTCCCTGGAAGACCCCTGCAGG + Exonic
1184277364 22:43417639-43417661 GGTCCCTGCAAGCAAAATGCAGG - Intronic
1184568516 22:45308089-45308111 GGGGCCTGGGAGCTCCATGAGGG + Intergenic
1184607510 22:45582511-45582533 GGTCCCAGGGAGCAGCATGATGG - Intronic
950497564 3:13343153-13343175 GGTCAGTGGAAGCTTCATGACGG - Exonic
952531744 3:34269585-34269607 GGTGACAGGAAGCAGCATGAGGG + Intergenic
953080096 3:39608750-39608772 TGTCCCAGGAAGCACCCAGATGG - Intergenic
955541771 3:59984277-59984299 GGGCCCAGGAAGCACCATTAGGG + Intronic
958610348 3:96416693-96416715 TGTCCCAGGAAGCACCTAGATGG - Intergenic
961403077 3:126660737-126660759 GGTCAGTGGAAGCTTCATGATGG + Intergenic
967258034 3:187613299-187613321 GGTCCCTGTTAGCACCCTCAGGG + Intergenic
968831050 4:2933227-2933249 GGTGCCAGGCAGCCCCATGATGG - Intronic
969158457 4:5233786-5233808 GGTCCATGGAAACAACATGGAGG + Intronic
969227444 4:5808087-5808109 GATCCCTGGGAGCCCCAAGAGGG - Intronic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
974990344 4:69079187-69079209 TGTCCCAGGAAACACCCTGATGG - Intronic
976748941 4:88434352-88434374 GGTATCTGAAAGTACCATGAAGG + Intronic
977993624 4:103476075-103476097 GGTCCCTGTACTTACCATGATGG - Intergenic
982104145 4:151997248-151997270 GGGCCCAGGAAGGACAATGAAGG + Intergenic
984279214 4:177648147-177648169 GGTACCTGGAAGGACCTGGATGG + Intergenic
985760483 5:1746311-1746333 GGGCCCTGGCAGGACCCTGAGGG + Intergenic
985961431 5:3306075-3306097 CCTCCCTGGGAGCACCCTGATGG - Intergenic
989254970 5:39356624-39356646 GCTCACTGGAAGCACAGTGAAGG + Intronic
991257762 5:64634019-64634041 GGTCCCTGTACCTACCATGATGG - Intergenic
992228669 5:74642066-74642088 GGACTCTGGAAGCGCCATGTGGG - Intronic
993405973 5:87512269-87512291 GGTTTCGGGAAACACCATGAGGG + Intergenic
994498181 5:100539731-100539753 GATCACAGGAAGCAGCATGATGG - Intronic
996599498 5:125245431-125245453 TGTCCCGGGAAGCACCCTGAAGG - Intergenic
999143035 5:149375261-149375283 GCTCCCTGAGAGCACCAGGAGGG - Intronic
999700474 5:154223530-154223552 TGTGCCAGAAAGCACCATGAAGG + Intronic
999860790 5:155643503-155643525 GGTCCCAGGAAGCACTAGTAAGG - Intergenic
1001051217 5:168416014-168416036 GCTCTCTGGAAGCCCCATGATGG - Intronic
1002346530 5:178551804-178551826 GGGCTCTGGAAACAGCATGAAGG - Intronic
1003387485 6:5682726-5682748 AATGCCTGGAAGCTCCATGAGGG - Intronic
1007211688 6:40197551-40197573 GATCCCAGGAAGCTCCAGGAGGG + Intergenic
1007258472 6:40545299-40545321 GGTCCCTGGACACAGAATGAAGG + Intronic
1007361130 6:41356712-41356734 GGTCTCTGAAAGCAGCATGGAGG - Intergenic
1014814072 6:125916459-125916481 GGGCCCTGGAAATACAATGATGG + Intronic
1016349900 6:143155779-143155801 GGTCCCTGGAAGAAACTGGAAGG + Intronic
1017237058 6:152127593-152127615 GTTCCCTAGAAACACCAGGAAGG + Intronic
1017740258 6:157400127-157400149 GGTCCAGGGAAGCAGCAGGAAGG - Intronic
1017991068 6:159490210-159490232 GGTTCATGGAAGCTTCATGAAGG + Intergenic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1020070495 7:5223858-5223880 GCTCCCTGGAGGCACCATTCAGG - Intronic
1021609588 7:22444494-22444516 GGTCCCTGGAATCCCCATGATGG - Intronic
1023518103 7:41023208-41023230 GGTCCCTCAAAGCTCCATGGGGG - Intergenic
1027987646 7:85314687-85314709 GGTCCCTTGTAGCACCAGGATGG + Intergenic
1028019242 7:85749967-85749989 TGTCCCTGGAAACACCTGGATGG + Intergenic
1028142985 7:87291930-87291952 TGTCCCAGGAAGCACCTAGATGG + Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1029903847 7:104071258-104071280 GGGCCATGGAAGGACCTTGAGGG - Intergenic
1030130219 7:106193599-106193621 GGTCCCAGGAAGCAGGAGGATGG + Intergenic
1034374524 7:150630557-150630579 GTTCCCTGGGAGCAGCAGGAAGG + Intronic
1035463480 7:159061068-159061090 CGTCCTTTGAAGCACCATGGAGG + Intronic
1042342747 8:67697175-67697197 GGACCCTGGGAACACCACGAGGG + Intronic
1045052078 8:98336548-98336570 GATCCAAGGAAGCACAATGAGGG + Intergenic
1045812038 8:106232900-106232922 GGTCACCTGAAACACCATGATGG - Intergenic
1046764975 8:118059405-118059427 GGTTGATGGAAACACCATGATGG + Intronic
1048209754 8:132445016-132445038 GTTACCTGGAAACACCCTGAAGG - Intronic
1049437817 8:142595769-142595791 GGTCCCTGGAGGGCCCATGCAGG - Intergenic
1049520805 8:143089223-143089245 GGTCCCTGCAGGCTCCATGGTGG - Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1050660614 9:7879511-7879533 GTTGCCTGGCACCACCATGAGGG - Intronic
1056604686 9:88076791-88076813 GGGCCCTGGAAGCTCCAGGCGGG - Intergenic
1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG + Intergenic
1057286947 9:93764417-93764439 GGTCCCTGGAAGCTGCCAGAAGG - Intergenic
1060963103 9:127695022-127695044 GCTCCCAGGAAGCACAGTGAGGG + Intronic
1061039506 9:128131762-128131784 GGTCCCTGGAAGCTCCAGGCTGG + Intergenic
1061278236 9:129581789-129581811 GTACCATGGAAGCCCCATGAAGG - Intergenic
1061328957 9:129880383-129880405 GGTCCCTGAAAGCACCTTCCTGG + Exonic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1185618135 X:1435678-1435700 TGTCCCGGTAAGCACCATGTTGG - Exonic
1185634916 X:1544752-1544774 GGACCCTTCAAACACCATGATGG - Intergenic
1187039469 X:15578641-15578663 GTTCCCTAGAAGCACCAAGAAGG + Intronic
1187226499 X:17378599-17378621 GTTCCCTGGAAGCACAGAGAGGG + Intronic
1187942103 X:24392307-24392329 GATCCCAGGAAGCACCAGTATGG + Intergenic
1189130315 X:38491541-38491563 GATCCCTGGAAGCACTAGTAGGG + Intronic
1190892842 X:54586309-54586331 GCTCCCTGGAAACTTCATGAAGG + Intergenic
1193277352 X:79604826-79604848 TGTCCCAGGAAGCACCCCGATGG + Intergenic
1196800375 X:119537889-119537911 GGTCCCAGGAAGGCCCAGGATGG - Intergenic
1199834495 X:151575124-151575146 GCCCCCTGCAATCACCATGATGG - Intronic
1200072556 X:153536354-153536376 GGCCCCTCGCAGCTCCATGAGGG - Exonic