ID: 1028522493

View in Genome Browser
Species Human (GRCh38)
Location 7:91747509-91747531
Sequence CATGGTGGCCCCATTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 9, 3: 18, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028522493_1028522498 2 Left 1028522493 7:91747509-91747531 CCTCAACCAATGGGGCCACCATG 0: 1
1: 0
2: 9
3: 18
4: 118
Right 1028522498 7:91747534-91747556 TGCCATACATGCATGCCCCAGGG No data
1028522493_1028522497 1 Left 1028522493 7:91747509-91747531 CCTCAACCAATGGGGCCACCATG 0: 1
1: 0
2: 9
3: 18
4: 118
Right 1028522497 7:91747533-91747555 GTGCCATACATGCATGCCCCAGG No data
1028522493_1028522503 23 Left 1028522493 7:91747509-91747531 CCTCAACCAATGGGGCCACCATG 0: 1
1: 0
2: 9
3: 18
4: 118
Right 1028522503 7:91747555-91747577 GGCTCAAAGACAGACCTATCTGG 0: 1
1: 0
2: 2
3: 16
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028522493 Original CRISPR CATGGTGGCCCCATTGGTTG AGG (reversed) Intronic
901192828 1:7422675-7422697 CAGCCTGGCCCCATTGGCTGTGG - Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901682278 1:10920176-10920198 CATAATAGCCCCATTGGCTGTGG - Intergenic
903380786 1:22895737-22895759 CATGGTGGCCGCTTAGGTAGTGG - Intronic
903857602 1:26345991-26346013 CATGGTGCCGCCAGTGGTGGTGG - Exonic
904121642 1:28202217-28202239 CACTGAGGCCCCATTTGTTGGGG + Intronic
905140295 1:35838286-35838308 CAAGGTGGGCCGATTGCTTGAGG - Intronic
905626376 1:39492488-39492510 CATGGGGGCCCCCTGGGCTGCGG + Intronic
905670520 1:39787967-39787989 CATGGGGGCCCCCTGGGCTGCGG - Intronic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
917570736 1:176262925-176262947 CATGGTGTCTTCACTGGTTGAGG + Intergenic
921058823 1:211565321-211565343 TGTGGTGCCCCCATTGATTGGGG + Intergenic
923936865 1:238771173-238771195 CATGGTGGCAGGATTGCTTGAGG - Intergenic
1065548521 10:26846573-26846595 CAAGGTGGGCCCATCGCTTGAGG - Intronic
1065731231 10:28711516-28711538 CAAGGTGGGCCCATTACTTGAGG + Intergenic
1067306665 10:45071041-45071063 CATTGTGGCCCCACTGCCTGGGG - Intergenic
1070158784 10:73853020-73853042 CATGGAGACCCCCTTGGTGGGGG + Intronic
1070510679 10:77157944-77157966 TCTGGTGCCCCCATGGGTTGGGG + Intronic
1070798477 10:79230923-79230945 CAAGGTGGCCCCATGGGTCAAGG + Intronic
1070976728 10:80611314-80611336 CATGGACGCCACATTGGTTCTGG - Intronic
1073462887 10:103676720-103676742 CATGGCAGCCCCTTGGGTTGCGG + Intronic
1076739775 10:132477481-132477503 CCTGCTTCCCCCATTGGTTGGGG + Intergenic
1077283009 11:1754044-1754066 CATGGTGGGCCCGGTGGATGAGG - Exonic
1083696986 11:64449626-64449648 TATTGTGGCTCCATTGGCTGAGG - Exonic
1088618062 11:111653153-111653175 CAGGGTGGCCCTTCTGGTTGAGG - Intronic
1089461489 11:118656736-118656758 CATGGTGGCCCCATCTGCAGAGG + Exonic
1091816933 12:3445922-3445944 CCTCCTGGCCCCATTGGTAGGGG + Intronic
1098183073 12:67869026-67869048 GTTGGTGACCCCTTTGGTTGGGG + Intergenic
1101407513 12:104441717-104441739 CAGGGTGGCAGCATTGGTGGAGG - Intergenic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG + Intronic
1107031997 13:35862630-35862652 GGTGGTAGCCCCGTTGGTTGTGG - Intronic
1107434651 13:40371776-40371798 CCTGCTGGCCCATTTGGTTGGGG + Intergenic
1107875701 13:44789018-44789040 CATGGTGGGCTCCGTGGTTGAGG + Intergenic
1118602069 14:67477836-67477858 CATGGTGGTGCCATTAATTGGGG - Intronic
1127337319 15:58001203-58001225 CAAAGTGGCACCACTGGTTGAGG + Intronic
1129842494 15:78752333-78752355 GATGGTGGCCCCAGTGTTGGAGG + Intergenic
1131533467 15:93214290-93214312 TATGGCGGCCTCATTGCTTGTGG + Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135937800 16:26795852-26795874 CATGCTGGCCCCATGGTCTGTGG - Intergenic
1137406615 16:48194090-48194112 CAAGGTGTCCACATTGGGTGGGG - Intronic
1138413573 16:56858415-56858437 CCTGGGGGAGCCATTGGTTGGGG + Intergenic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1150624293 17:66831807-66831829 CATGGATTCCCCATTGGTAGGGG - Intergenic
1158776596 18:60589434-60589456 CAAGGTGGAACCATTGGTTTTGG - Intergenic
1161208468 19:3054283-3054305 CATGATGGCCCACTTGGTAGTGG - Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1163575555 19:18109322-18109344 CTTGAAGGCCCCAGTGGTTGGGG + Intronic
1165767485 19:38360392-38360414 TGTGGTGGCCCCATTGTTTGAGG - Intronic
927875649 2:26653625-26653647 GATGGTGGCCCCCTGGGGTGTGG - Intergenic
930801769 2:55450117-55450139 CATGGTGTCCACATTGCATGTGG + Intergenic
930802263 2:55455220-55455242 CATGGTGTCCACATTGCATGTGG + Intergenic
935569833 2:104647576-104647598 CTTGATGGACCCCTTGGTTGAGG - Intergenic
936442253 2:112564663-112564685 TATACTGGCCTCATTGGTTGGGG + Intronic
937302787 2:120853400-120853422 CATGGTTCCACCATTGGTTCTGG + Intronic
938314797 2:130318075-130318097 CATTTGGGCCCCATGGGTTGGGG + Intergenic
941624895 2:167820605-167820627 CATTGTGGGTCCATGGGTTGGGG - Intergenic
946408630 2:219505740-219505762 CAAGGTGGCCCCCTCGGCTGTGG + Exonic
947388490 2:229616215-229616237 CATGGTGGCCCCATAGCCCGTGG - Intronic
1174114798 20:48219556-48219578 CAAGGAGGCCCCTGTGGTTGAGG + Intergenic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1174728459 20:52889956-52889978 CATGATGGACTCATGGGTTGAGG + Intergenic
1175591932 20:60200313-60200335 CAGGGAGGCCCTATTGGGTGAGG + Intergenic
1183885337 22:40875779-40875801 CAAGGTGGGCCGATTGCTTGAGG + Intronic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
962787085 3:138778521-138778543 CATGATGGACACATTGGCTGTGG - Intronic
963936622 3:151060462-151060484 CTTGTTTTCCCCATTGGTTGAGG + Intergenic
968703876 4:2069315-2069337 CTTGGTGGCCCCATGGGCTGAGG + Intergenic
970175666 4:13336988-13337010 CATGGTGAGCCTATTGGTAGGGG + Intergenic
970449294 4:16151060-16151082 CATTGTTGCCCCATAGGCTGAGG - Intergenic
970752953 4:19387603-19387625 CATGGTGGCTCCATAAGTGGTGG - Intergenic
972830715 4:42810722-42810744 AATGGTGGCACCATTTATTGAGG + Intergenic
976693344 4:87892352-87892374 CATGGTGAGCCCATTGGCAGGGG + Intergenic
976777718 4:88724020-88724042 CATGATGGCCTCATTGGCTTGGG + Intergenic
984070119 4:175100620-175100642 CATGGTGGAGCCAATGGATGGGG + Intergenic
984872920 4:184343201-184343223 CATGGTGACCTCTTTGGTGGAGG + Intergenic
985957157 5:3274398-3274420 CATGGTAGCCACATAGGGTGAGG - Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
993636536 5:90351479-90351501 GATGGTGCCCCCCTAGGTTGAGG - Intergenic
995313386 5:110739060-110739082 CGTGGTGGCCCCGGTGGTGGTGG + Exonic
999736697 5:154518349-154518371 GATTGTGGCCCCATTGGCTGGGG + Intergenic
999848554 5:155512442-155512464 CATGGCTGCTCCATGGGTTGGGG - Intergenic
1000801831 5:165737173-165737195 CATGGTAGCCCCATTGCTGAAGG + Intergenic
1001207657 5:169779405-169779427 CATGGTGGTGCCTGTGGTTGGGG + Intronic
1006005428 6:30998092-30998114 CATGGTGGGACGATTGCTTGGGG + Intergenic
1006592705 6:35170012-35170034 CATGGTGGCCCCCATAGTAGGGG + Intergenic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1012595398 6:101032429-101032451 GATGATGGCCCCTTTTGTTGGGG + Intergenic
1015445962 6:133305060-133305082 CATGGAGGCCCAATTAATTGAGG + Intronic
1017626031 6:156349704-156349726 CCTGGTGGCCCCAAGGGTGGAGG + Intergenic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1023232836 7:38051857-38051879 CATGGTGATTCCATTGCTTGGGG + Intergenic
1027707736 7:81555335-81555357 CATAGTGGCCCTATCTGTTGGGG - Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1030401650 7:109059174-109059196 CATGGGGGCCACTGTGGTTGGGG + Intergenic
1031113782 7:117644868-117644890 CATGAGAGCCCCATTGGTTTAGG + Intronic
1032135401 7:129272288-129272310 TAAGGTGGCTCCATTGATTGAGG - Intronic
1035060535 7:156066228-156066250 CATGGTGGCCCATTTGAGTGGGG + Intergenic
1046949702 8:120008210-120008232 CATGGTGGAGCCCTTGGTGGAGG + Intronic
1055438522 9:76316489-76316511 CATGGTGGGCGCACTGCTTGAGG + Intronic
1059449351 9:114360614-114360636 CATGCTGGCCCTATGGTTTGGGG - Intronic
1059516505 9:114900747-114900769 CATGGTGGGCAGATTGCTTGAGG + Intronic
1061400161 9:130364157-130364179 CATGGCGGCCCCATCAGGTGGGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1185550635 X:980706-980728 CATGGCAGCCCCAGTGGTTGAGG - Intergenic
1186007151 X:5085315-5085337 CATGTTGACCCCATTTTTTGTGG + Intergenic
1190075440 X:47313748-47313770 CATGGTGGCTCACTTTGTTGTGG + Intergenic
1190435352 X:50419058-50419080 CATAGTGGCCTCATTGATTGGGG + Intronic
1190526471 X:51333408-51333430 CATGGAGTTTCCATTGGTTGGGG - Exonic
1190542770 X:51495980-51496002 CATGGAGTTTCCATTGGTTGGGG + Exonic
1195489822 X:105454555-105454577 CATGTTGGCTCCTTTGGTTTGGG - Intronic
1196581072 X:117379721-117379743 CATGGTGCCAGCATTGGTTGAGG + Intergenic
1197143061 X:123138180-123138202 CATGTTGGCCCCTTTGGTATGGG + Intergenic
1198469019 X:136928917-136928939 TTTGGTGGCCTCATGGGTTGAGG - Intergenic
1199084268 X:143610643-143610665 CATGGTGCCCACATCGGGTGAGG - Intergenic
1200168085 X:154051053-154051075 CTTGGTGGCTCCCTTGGATGTGG + Intronic
1202069149 Y:20972504-20972526 CATGGAAGCCACATTGCTTGGGG - Intergenic
1202377431 Y:24250305-24250327 CAGGCTGGCCACATTGGGTGAGG + Intergenic
1202493349 Y:25419816-25419838 CAGGCTGGCCACATTGGGTGAGG - Intergenic