ID: 1028522928

View in Genome Browser
Species Human (GRCh38)
Location 7:91752448-91752470
Sequence TCCCACTGCCTCCTTTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 0, 2: 15, 3: 160, 4: 1442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028522928_1028522931 -4 Left 1028522928 7:91752448-91752470 CCCAGCCAAAGGAGGCAGTGGGA 0: 1
1: 0
2: 15
3: 160
4: 1442
Right 1028522931 7:91752467-91752489 GGGAAGCCACACTTTTTCCAAGG 0: 1
1: 7
2: 21
3: 91
4: 357
1028522928_1028522935 20 Left 1028522928 7:91752448-91752470 CCCAGCCAAAGGAGGCAGTGGGA 0: 1
1: 0
2: 15
3: 160
4: 1442
Right 1028522935 7:91752491-91752513 TCTGTGCAACCCACAGATCAGGG No data
1028522928_1028522934 19 Left 1028522928 7:91752448-91752470 CCCAGCCAAAGGAGGCAGTGGGA 0: 1
1: 0
2: 15
3: 160
4: 1442
Right 1028522934 7:91752490-91752512 ATCTGTGCAACCCACAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028522928 Original CRISPR TCCCACTGCCTCCTTTGGCT GGG (reversed) Intronic
900224183 1:1525030-1525052 TCCCACGGCCTTCTGAGGCTGGG + Intronic
900852649 1:5156170-5156192 TCCCACTGCCTACTGGGGCCTGG + Intergenic
901685042 1:10939052-10939074 TCCTGCTGCCTCCTGTGGGTAGG + Intergenic
901703878 1:11059623-11059645 TCACACCGCCTCCCTGGGCTGGG - Intronic
901872238 1:12144942-12144964 TCCCCCTGCCTCCCAGGGCTTGG - Intergenic
901970815 1:12906307-12906329 TCCAACTTCCTCCTTTATCTCGG - Intronic
902014351 1:13295463-13295485 TCCAACTTCCTCCTTTATCTCGG + Intergenic
902101718 1:13996129-13996151 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
902784010 1:18721361-18721383 ACCCACCGCCACCTCTGGCTTGG - Intronic
903577277 1:24346707-24346729 TCCCAAAGCCTCCTTGGGGTGGG + Intronic
903843094 1:26258554-26258576 TGCCTCTCTCTCCTTTGGCTAGG - Intronic
904042968 1:27594640-27594662 TCCCAGAGCCTCCTCTGCCTGGG - Intronic
904108292 1:28104855-28104877 TCCCATTGCCTTCTTTGGTAGGG - Intergenic
904430061 1:30458525-30458547 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
904756291 1:32770538-32770560 TCCCACTGCCTCCCTGGGGAGGG - Exonic
905383907 1:37585690-37585712 ACTCACTGCCTCTTTTTGCTTGG + Intronic
905840945 1:41177440-41177462 TCGAACTTCCTCCTTTAGCTCGG - Intronic
905843411 1:41205283-41205305 TGTCACGGCCTCCCTTGGCTAGG - Intronic
905952547 1:41964330-41964352 ACTCACTGCCTCCCTTGGCTGGG - Intronic
906155476 1:43611706-43611728 TCCCACTGCCACCTTTCACTTGG - Intronic
906374709 1:45285748-45285770 TCGAACTTCCTCCTTTAGCTCGG - Intronic
906755732 1:48312747-48312769 TCTAACTTCCTCCTTTAGCTTGG - Intronic
906858198 1:49330983-49331005 ACTCACTGCTTCCCTTGGCTGGG - Intronic
906908056 1:49916284-49916306 TCGAACTTCCTCCTTTAGCTTGG - Intronic
906944700 1:50285758-50285780 CCCCACTTCTTCCTTTGGGTGGG - Intergenic
907510943 1:54958566-54958588 TCTAACTGCCTCCTTTGGAAAGG + Intergenic
907580316 1:55566764-55566786 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
907780854 1:57564483-57564505 TCAGACTTCCTCCTTTAGCTCGG - Intronic
907958243 1:59251998-59252020 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
907994126 1:59611699-59611721 TCGAACTTCCTCCTTTAGCTCGG - Intronic
908450642 1:64251631-64251653 ACTCACTGCCTCCCTTGTCTTGG - Intronic
908637977 1:66189775-66189797 TCGAACTTCCTCCTTTAGCTTGG + Intronic
908726351 1:67181574-67181596 TCAAACTTCCTCCTTTAGCTCGG + Intronic
908876748 1:68686438-68686460 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
909307177 1:74096492-74096514 TATAACTTCCTCCTTTGGCTTGG + Intronic
909427165 1:75538912-75538934 TGCCACTGGCTCCTGTGACTGGG - Intronic
909514036 1:76487667-76487689 TCGAACTTCCTCCTTTAGCTTGG + Intronic
909521820 1:76577316-76577338 TGCCACTGCCTCTTTCTGCTTGG + Intronic
909677753 1:78257143-78257165 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
909720768 1:78767246-78767268 ACCCACTGCTTCCCTTGTCTAGG - Intergenic
910111589 1:83689434-83689456 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
910318952 1:85921868-85921890 TCCAACATCCTCCTTTAGCTCGG - Intronic
910619435 1:89236515-89236537 ACTCAACGCCTCCTTTGGCTGGG + Intergenic
910816681 1:91297988-91298010 TCAAACTTCCTCCTTTAGCTTGG - Intronic
910822640 1:91367802-91367824 TCAAACTTCCTCCTTTAGCTTGG - Intronic
910829106 1:91442031-91442053 TGTCACAGCCTCCCTTGGCTAGG - Intergenic
910945799 1:92590315-92590337 TCGAACTTCCTCCTTTAGCTCGG - Intronic
910949860 1:92634620-92634642 TCGAACTTCCTCCTTTAGCTCGG + Intronic
910974570 1:92892701-92892723 TCGAACTTCCTCCTTTAGCTCGG - Intronic
911106407 1:94135301-94135323 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
911218026 1:95216755-95216777 TCTCACGGCTTCCCTTGGCTAGG + Intronic
911242700 1:95483093-95483115 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
911284680 1:95975139-95975161 TCTCACTGCTTCCTTTGGCTGGG + Intergenic
911399545 1:97358042-97358064 TCTCACGGCATCCCTTGGCTAGG - Intronic
911851607 1:102827678-102827700 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
911867765 1:103050542-103050564 TCGAACTTCCTCCTGTGGCTCGG + Intronic
911891577 1:103378391-103378413 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
911902440 1:103523438-103523460 TACCACTGCCTCCTACGGTTAGG - Intergenic
911963531 1:104337280-104337302 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
911991639 1:104705694-104705716 TCTCATTGCCTCCTTTGGAAAGG + Intergenic
912062327 1:105687674-105687696 TCCCTCTCCCTCCTTTACCTTGG - Intergenic
912285302 1:108363257-108363279 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
913285119 1:117218799-117218821 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
913408045 1:118517688-118517710 TGTCACAGCTTCCTTTGGCTAGG + Intergenic
913467288 1:119156213-119156235 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
913468938 1:119171409-119171431 TCTCAGTGCCTCCTCTGCCTGGG + Intergenic
913710400 1:121477356-121477378 TGTCACTCCCTCCCTTGGCTAGG - Intergenic
913721699 1:121603116-121603138 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
914400541 1:147316273-147316295 TCTCACTGCCTCCCCTGGCTTGG - Intergenic
914404510 1:147357811-147357833 ACTTACTGCCTCCCTTGGCTGGG - Intergenic
914438513 1:147681265-147681287 TCTCAGTGCCTCCTCTGCCTGGG - Intergenic
914562576 1:148835376-148835398 TCGAACTTCCTCCTTTAGCTCGG + Intronic
914610254 1:149294846-149294868 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
914996985 1:152552731-152552753 TCAAACTTCCTCCTTTAGCTTGG + Intronic
915061426 1:153188878-153188900 CCTCACGGCTTCCTTTGGCTAGG + Intergenic
915530324 1:156499386-156499408 TCCCTCTGCCTCCCATTGCTTGG - Intronic
915654550 1:157348498-157348520 CCTCACAGCCTCCCTTGGCTAGG + Intergenic
915752029 1:158220738-158220760 TCAGACTTCCTCCTTTAGCTCGG + Intergenic
915987349 1:160480244-160480266 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
916154760 1:161833455-161833477 TCGAACTTCCTCCTTTAGCTCGG - Intronic
916351336 1:163853335-163853357 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
916475714 1:165166620-165166642 ACCCACCGTCTCCTATGGCTGGG + Intergenic
916479409 1:165201649-165201671 TCCCACTGCCTCCTTCTGTGGGG + Intergenic
916580354 1:166101389-166101411 TCAAACTTCCTCCTTTAGCTCGG - Intronic
916849094 1:168684381-168684403 ACTCACTGTCTCCTTTGGCTGGG + Intergenic
916938488 1:169656176-169656198 CCTCACTGCTTCCCTTGGCTAGG - Intergenic
917024949 1:170631553-170631575 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
917059066 1:171017362-171017384 ACTCACTGCCTCCCTTGGCTGGG - Intronic
917269574 1:173258401-173258423 ACTCACTGTCTCCTTTGGCTGGG - Intergenic
917289654 1:173459997-173460019 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
917305136 1:173616943-173616965 ACTCACTGCTTCCCTTGGCTGGG - Intronic
917383172 1:174437269-174437291 TCGAACTTCCTCCTTTAGCTCGG - Intronic
917406293 1:174711336-174711358 TCTCAGTGCCTCCTCTGCCTGGG - Intronic
917686474 1:177421635-177421657 TCCTACTTGCTCCCTTGGCTGGG + Intergenic
917827512 1:178838714-178838736 TCGAACTTCCTCCTTTAGCTCGG - Intronic
918003334 1:180519021-180519043 TCCCACTGCTTCACTTGACTAGG - Intergenic
918156157 1:181849045-181849067 ACTCACTGCCTCTCTTGGCTTGG - Intergenic
918512080 1:185322180-185322202 TCTCAGTGCCTCCTCTGCCTGGG - Intergenic
918541637 1:185638817-185638839 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
918697401 1:187560868-187560890 ACTCACTGCCTCCCTTGGATGGG + Intergenic
918786229 1:188768402-188768424 CCTCACTGCCTCCCTTGGCTGGG - Intergenic
918832545 1:189416424-189416446 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
919623190 1:199885889-199885911 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
920019561 1:202944632-202944654 TACCACACCCTACTTTGGCTTGG + Intronic
920125739 1:203692603-203692625 TTCTGCTGCCTCCTTTGGCAAGG + Intronic
920530168 1:206695968-206695990 TTCTACTTCCTCCTATGGCTCGG + Intronic
920955358 1:210615379-210615401 TCGAACTTCCTCCTTTAGCTCGG + Intronic
920987685 1:210906004-210906026 TCCCACTTCCTCTTCTGGCTTGG + Intronic
921053625 1:211528000-211528022 ACCCACTGCCTTCTTGAGCTTGG + Intergenic
921288367 1:213630520-213630542 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
921916055 1:220611476-220611498 TGTCACGGCTTCCTTTGGCTAGG + Intronic
921918602 1:220641838-220641860 CCTCACTGCCTCTCTTGGCTCGG - Intronic
922748963 1:228061943-228061965 TCTCCCTGCCTTCCTTGGCTGGG - Intergenic
923431586 1:233926573-233926595 TCCTACATCCTCCTTTAGCTTGG + Intronic
923942676 1:238844929-238844951 GCTCAATGCCTCCCTTGGCTTGG + Intergenic
924064147 1:240207076-240207098 TGACACTGCCTCCTGTGGATGGG + Exonic
924731485 1:246715384-246715406 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
924883613 1:248188862-248188884 CCTCACTGCTTCCCTTGGCTGGG - Intergenic
1062776328 10:151265-151287 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1062979125 10:1707271-1707293 TCCCTCTGCCTCCTCTGACGAGG - Intronic
1063522249 10:6751564-6751586 TCACACTGTCTCCTTTTCCTGGG - Intergenic
1063829820 10:9940185-9940207 TCCCACTGCCTCACTGGGCCAGG + Intergenic
1064037535 10:11926750-11926772 TCCCACTGCCAGCTGTGACTTGG + Intronic
1064914436 10:20441145-20441167 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1065060810 10:21899058-21899080 ACTCACTGCTTCCCTTGGCTGGG - Intronic
1065157684 10:22886834-22886856 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1065192348 10:23224578-23224600 TCTAACTTCCTCCTTTAGCTCGG - Intronic
1065237744 10:23671371-23671393 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1065463580 10:25995446-25995468 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1065594892 10:27300429-27300451 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1065649783 10:27875791-27875813 TCTCACAGCTTCCCTTGGCTAGG - Intronic
1066152746 10:32641593-32641615 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1066582606 10:36897869-36897891 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1066584069 10:36912981-36913003 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1066595857 10:37049450-37049472 TCTAACTTCCTCCTTTAGCTTGG + Intergenic
1066709460 10:38217455-38217477 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1066751371 10:38660381-38660403 TCCAACGTCCTCCTTTAGCTCGG - Intergenic
1066785182 10:38995508-38995530 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
1066965670 10:42262711-42262733 TCCAACATCCTCCTTTAGCTCGG + Intergenic
1067127636 10:43533382-43533404 TGTCACAGCTTCCTTTGGCTAGG + Intergenic
1067236443 10:44454426-44454448 TCTCACGGCTTCCCTTGGCTAGG + Intergenic
1067239757 10:44480528-44480550 TGTCACAGCTTCCTTTGGCTAGG - Intergenic
1067326582 10:45274293-45274315 TCTCATTGCCTCCTTTGGAAAGG + Intergenic
1067339402 10:45388892-45388914 TCCAACTTCCTTCTTTAGCTGGG - Intronic
1067849037 10:49743516-49743538 ACCGACTGCATCCCTTGGCTGGG - Intronic
1067955559 10:50787384-50787406 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1068391904 10:56408840-56408862 ACTCACTGCCTCCATTGGCTGGG - Intergenic
1068970264 10:62950807-62950829 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1069057143 10:63856631-63856653 TCGTACTTCCTCCTTTAGCTTGG + Intergenic
1069360587 10:67637064-67637086 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1071005800 10:80882651-80882673 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1071058986 10:81548065-81548087 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1071074708 10:81736137-81736159 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1071522411 10:86339466-86339488 TCCCACTGCACCCTGTGGCTGGG + Intronic
1071748140 10:88444521-88444543 TCAAACTTCCTCCTTTAGCTTGG - Intronic
1072297054 10:94019288-94019310 TCCCACTTGCTCCTTTAGCTGGG - Intronic
1072361650 10:94664751-94664773 ACTCGCTGCCTCCCTTGGCTGGG + Intergenic
1072382893 10:94893543-94893565 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1072921590 10:99581636-99581658 TCCCACTTCCTCAAGTGGCTGGG - Intergenic
1073016953 10:100407515-100407537 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1073043344 10:100621889-100621911 TCTCACTGTCGCCTTTGTCTCGG - Intergenic
1073081972 10:100866014-100866036 TCCCCATGCACCCTTTGGCTGGG - Intergenic
1073488032 10:103834029-103834051 TCCCATTGCTTCCTCTGGCCTGG - Intronic
1073587451 10:104724917-104724939 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1074003268 10:109393410-109393432 ACTCACTGCCTCCCTTGGCTTGG - Intergenic
1074109179 10:110410525-110410547 TCTCACTGCACCCTTTGGCCTGG + Intergenic
1074179341 10:111044323-111044345 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1074480103 10:113811596-113811618 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1075172462 10:120128185-120128207 ACTCACTGCCTCCCTTGGCTTGG + Intergenic
1075230344 10:120671227-120671249 ACACACTGCCTCCCTTGGCTGGG - Intergenic
1075312620 10:121427435-121427457 TCCTATTTCCTCCTTTTGCTGGG - Intergenic
1076103069 10:127797941-127797963 TCCTACTGCCTCCTTTTGCAAGG + Intergenic
1076169493 10:128307699-128307721 TCCCACTGCTTTCCTGGGCTAGG + Intergenic
1076185047 10:128440304-128440326 ACTCACTGCCTCCCTTAGCTGGG - Intergenic
1076526744 10:131116892-131116914 TCTCTTTGCCTCCTCTGGCTTGG + Exonic
1077450347 11:2639155-2639177 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1077603175 11:3588589-3588611 TCTCGGTGCCTCCTTTGCCTGGG + Intergenic
1077771164 11:5220922-5220944 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1077854997 11:6115617-6115639 ACTCACTGCCTTCCTTGGCTGGG - Intergenic
1078111539 11:8397661-8397683 TCAGACTTCCTCCTTTAGCTCGG - Intronic
1078485189 11:11716232-11716254 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1078519889 11:12054169-12054191 TCCCACTGCCTCCCTAGGCCTGG - Intergenic
1078562100 11:12381121-12381143 ACCCACTGCCTTCTTTGCCTGGG - Intronic
1078691154 11:13582195-13582217 ACTCACCGCCTCCGTTGGCTGGG - Intergenic
1078751893 11:14173434-14173456 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1079588119 11:22150423-22150445 ACTCACTGCCTCTCTTGGCTAGG + Intergenic
1079752685 11:24218295-24218317 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1079755090 11:24248755-24248777 TCCCACTGCCTTCTTGGGCCTGG - Intergenic
1079800198 11:24859761-24859783 ACTCATCGCCTCCTTTGGCTGGG - Intronic
1079981609 11:27157193-27157215 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1080106095 11:28512830-28512852 TCTCAGTGCCTCCTCTGCCTGGG - Intergenic
1080164960 11:29225148-29225170 AGTCACTGCCTCTTTTGGCTGGG + Intergenic
1080783189 11:35449815-35449837 ACTAACTGCCTCCTTTGGCTGGG + Intronic
1081374776 11:42344832-42344854 TCTCAGTGCCTCCTTGGCCTCGG - Intergenic
1081405159 11:42689205-42689227 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1081433680 11:43004310-43004332 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1081454281 11:43206173-43206195 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1081744631 11:45464283-45464305 TCTCTCTGGCTCCTGTGGCTGGG - Intergenic
1082107397 11:48235610-48235632 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1082127862 11:48453863-48453885 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
1082135685 11:48546844-48546866 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1082147180 11:48684201-48684223 TCCAACTTCCTCCTTTAGCTCGG - Intergenic
1082249554 11:49963557-49963579 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1082253380 11:50006143-50006165 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1082619004 11:55398205-55398227 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1082647710 11:55748616-55748638 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1082860331 11:57849039-57849061 TCGAACATCCTCCTTTGGCTCGG - Intergenic
1082876381 11:57992902-57992924 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
1082905962 11:58309080-58309102 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1082956522 11:58876231-58876253 TCTAACTTCCTCCTTTAGCTTGG + Intronic
1082993862 11:59233468-59233490 CCTCACTGCCTCCCTTGGCTTGG - Intergenic
1083009799 11:59386589-59386611 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1083062836 11:59892244-59892266 TCTCACCGCCTCCCTTGACTGGG + Intergenic
1083300389 11:61737100-61737122 ACCCTCTGCCTCCCTTGGGTTGG + Intronic
1083355305 11:62061816-62061838 TCCCACTGCCTTCTCTGGGGAGG + Intergenic
1083509055 11:63190487-63190509 TCGAACTTCCTTCTTTGGCTCGG + Intronic
1083516463 11:63263418-63263440 ACTCACTCCCTCCCTTGGCTGGG + Intronic
1084259065 11:67963131-67963153 TCTCAGTGCCTCCTCTGCCTGGG + Intergenic
1084267092 11:68010652-68010674 TGCCACCGCCTCCTTTTCCTGGG + Intronic
1084825239 11:71724885-71724907 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1085066221 11:73498331-73498353 ATTCACTGCCTCCCTTGGCTGGG - Intronic
1085162556 11:74361598-74361620 TCGGACTTCCTCCTTTAGCTTGG - Intronic
1085222725 11:74888618-74888640 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1085248097 11:75120466-75120488 TCCAACTTCCTCCTTTAGCTCGG - Intronic
1085495515 11:76965010-76965032 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1085942613 11:81222902-81222924 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1085966921 11:81539228-81539250 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1086012409 11:82121143-82121165 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1086691393 11:89790949-89790971 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1086714410 11:90048707-90048729 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1086724972 11:90170869-90170891 TCCCACCAACGCCTTTGGCTTGG - Intronic
1086730380 11:90241248-90241270 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1086757460 11:90582404-90582426 TCAGACTTCCTCCTTTGGCTCGG + Intergenic
1086771756 11:90775378-90775400 ATGCACTGCCTCCCTTGGCTGGG + Intergenic
1086811925 11:91321243-91321265 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1087050195 11:93879086-93879108 TCTTACTGCCTCCTTTGGAGAGG - Intergenic
1087080020 11:94161662-94161684 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1087101753 11:94371556-94371578 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1087103295 11:94385398-94385420 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1087328749 11:96753872-96753894 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1087354290 11:97074458-97074480 ACTCACTGCTTCCCTTGGCTGGG + Intergenic
1087596064 11:100256715-100256737 TCTCACAGCTTCCCTTGGCTAGG - Intronic
1087616320 11:100489883-100489905 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1087878820 11:103391438-103391460 TCAGACTTCCTCCTTTAGCTCGG + Intronic
1087881231 11:103418752-103418774 ACTCACTGCTTCCCTTGGCTGGG - Intronic
1088037360 11:105334021-105334043 ACTCACTGCCTCCCTTGGCTTGG - Intergenic
1088155410 11:106797215-106797237 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1088167704 11:106957505-106957527 CACCACCGCCTCCTTTGGCTTGG + Intronic
1088727489 11:112652549-112652571 TCCGATTGCCTCCTTTGGAAAGG - Intergenic
1088790890 11:113225133-113225155 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1089106069 11:116006101-116006123 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1090117149 11:123985119-123985141 ACTCACTGCCTCCCTTGGCTAGG + Intergenic
1090269623 11:125377010-125377032 CTCCACTGACTCATTTGGCTGGG - Intronic
1090308791 11:125716445-125716467 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1090321068 11:125844328-125844350 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1090322264 11:125857576-125857598 TCTCACGGCTTCCCTTGGCTAGG - Intergenic
1090747009 11:129713727-129713749 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1091052413 11:132384605-132384627 TCTAACTTCCTCCTTTAGCTTGG - Intergenic
1091113317 11:132991732-132991754 TCCCAGTGCCTTCATTTGCTGGG + Intronic
1091246724 11:134102564-134102586 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1091299297 11:134497210-134497232 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1091424498 12:375516-375538 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1091712299 12:2750564-2750586 CCCCACGGCTTCCCTTGGCTAGG + Intergenic
1092325604 12:7528053-7528075 CCTCACTGTCTCCTTTGGCTGGG + Intergenic
1092327042 12:7543844-7543866 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1092417865 12:8306004-8306026 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1092443259 12:8527908-8527930 ACCGACTGCCTCCCTTGGCTCGG + Intergenic
1093086378 12:14869961-14869983 ACTCACTGCTTCCTGTGGCTGGG + Intronic
1093314117 12:17627468-17627490 TCAAACTTCCTCCTTTGGATCGG + Intergenic
1093340535 12:17967734-17967756 ACTCACCACCTCCTTTGGCTGGG + Intergenic
1093383439 12:18521962-18521984 ACTTACTGCCTCCCTTGGCTGGG + Intronic
1093501381 12:19815690-19815712 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1093522422 12:20066700-20066722 TCTCACCACCTCCCTTGGCTGGG - Intergenic
1093672919 12:21899556-21899578 TGTCACAGCCTCCCTTGGCTAGG - Intronic
1093808371 12:23464183-23464205 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1093829005 12:23732172-23732194 TCCTACTGCCTCCTTTTTCTTGG - Intronic
1094132696 12:27091863-27091885 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1094162476 12:27405793-27405815 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1094273864 12:28646388-28646410 TCTCACCACCTCCCTTGGCTTGG + Intergenic
1094425222 12:30310146-30310168 ACTCACTGCTTCCCTTGGCTTGG - Intergenic
1094651145 12:32376916-32376938 TCCCCCTACCTGCTTGGGCTTGG - Intronic
1094728374 12:33146717-33146739 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1094792343 12:33929446-33929468 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1094803566 12:34066166-34066188 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1094809805 12:34125982-34126004 TTCCTCTGCTTCCTTTGGTTGGG + Intergenic
1095151136 12:38797749-38797771 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1095217635 12:39568568-39568590 TCGAACTCCCTCCTTTAGCTCGG + Intronic
1095224950 12:39668994-39669016 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1095483307 12:42658309-42658331 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1095805209 12:46312004-46312026 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1095827520 12:46545825-46545847 TGTCACAGCTTCCTTTGGCTGGG + Intergenic
1096253811 12:50050983-50051005 CGGCACTGCCTCCTCTGGCTGGG + Intergenic
1096355818 12:50939932-50939954 TCCCACTGCTTCAATTGACTAGG - Intergenic
1096950083 12:55459526-55459548 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1097153806 12:56998115-56998137 TATCACTGCCTCCTCTGACTTGG + Intergenic
1097160656 12:57044341-57044363 TTCCCCTGCCTCCTTTGTTTTGG + Intronic
1097529557 12:60781093-60781115 ACTCACTGCCTCTCTTGGCTGGG + Intergenic
1097569764 12:61317918-61317940 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1097598595 12:61664593-61664615 ACTCACTGCCTCCTTTGGCAGGG + Intergenic
1097740926 12:63241572-63241594 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1097748873 12:63330533-63330555 ACTCACTGCCTCCTTTGGCTTGG - Intergenic
1097924172 12:65109456-65109478 TCCCACTTGCCCCTTTGGTTGGG + Intronic
1098692172 12:73502972-73502994 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1099008556 12:77263932-77263954 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1099240025 12:80127981-80128003 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1099502720 12:83432991-83433013 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1099677979 12:85786599-85786621 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1099684390 12:85866392-85866414 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
1099764999 12:86971578-86971600 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1099793354 12:87363876-87363898 ACTCACTGCCTCCCTTGGATGGG + Intergenic
1100115014 12:91294066-91294088 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1100563943 12:95776361-95776383 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1100742363 12:97608164-97608186 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1101066457 12:101027149-101027171 ACTCACTGCCTCCCTTGGCTGGG - Intronic
1101313983 12:103612627-103612649 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1101524758 12:105518805-105518827 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1101528494 12:105553575-105553597 TAACACTGTCTCCTTTGTCTGGG - Intergenic
1103153464 12:118662836-118662858 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1104256480 12:127143518-127143540 ACTCACTGCGTCCCTTGGCTGGG + Intergenic
1105072842 12:133246125-133246147 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1105214885 13:18278254-18278276 TCCCCCTGCTTCCGTTGCCTGGG - Intergenic
1105335146 13:19460275-19460297 ACTCACTGCTTCCCTTGGCTGGG + Intronic
1105859771 13:24399111-24399133 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1105875888 13:24553351-24553373 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1106019062 13:25897976-25897998 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1106357583 13:28998832-28998854 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1106445655 13:29828617-29828639 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1106847048 13:33747990-33748012 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1107314895 13:39120231-39120253 CCTCACCGCCTCCCTTGGCTGGG + Intergenic
1107885180 13:44869091-44869113 TTCTCCTGCCTCCTATGGCTTGG - Intergenic
1108144584 13:47463525-47463547 ACTCACTGCCTCCTTTGGCGGGG - Intergenic
1108153704 13:47563824-47563846 TCTCACAGCTTCCCTTGGCTGGG - Intergenic
1108547877 13:51514641-51514663 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1108553350 13:51568210-51568232 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1108561968 13:51653346-51653368 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1108629683 13:52269336-52269358 ACTCACTGCTTCCCTTGGCTGGG + Intergenic
1108656374 13:52537152-52537174 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1109072603 13:57787835-57787857 ACTCACTGCCTCCCTTGGCTAGG + Intergenic
1109097343 13:58134638-58134660 ACTCACTGCTTCCCTTGGCTTGG + Intergenic
1109113351 13:58351498-58351520 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1109322844 13:60832140-60832162 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1109968667 13:69737104-69737126 CCTCACTGCCTTCTTTGGCTAGG - Intronic
1110162149 13:72391132-72391154 TCCCACTGCCTCCACTACCTTGG - Intergenic
1110415330 13:75246105-75246127 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1110510261 13:76342517-76342539 TGTCACGGCCTCCCTTGGCTAGG - Intergenic
1110652624 13:77959738-77959760 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1110729123 13:78859848-78859870 TCCAACTTCTTCCTTTAGCTCGG + Intergenic
1110836966 13:80094071-80094093 AGTCACTGCCTCCCTTGGCTGGG + Intergenic
1111092115 13:83461742-83461764 ACTCACTGCCTCCCTTGCCTGGG - Intergenic
1111680676 13:91438105-91438127 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1111966993 13:94871010-94871032 TGTCACAGCTTCCTTTGGCTAGG - Intergenic
1112178602 13:97054071-97054093 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1112663705 13:101543994-101544016 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1113021183 13:105889323-105889345 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1113131623 13:107043159-107043181 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
1113288672 13:108881496-108881518 TCCAACATCCTCCTTTAGCTCGG - Intronic
1113590981 13:111501065-111501087 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1114133625 14:19821156-19821178 TCTCACGGCTTCCCTTGGCTGGG + Intronic
1114141098 14:19911664-19911686 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1114171952 14:20281233-20281255 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1114240385 14:20861307-20861329 TCGAACATCCTCCTTTGGCTCGG - Intergenic
1114266970 14:21078362-21078384 TCCCACTGCCTCCTGGGGATAGG - Exonic
1114598013 14:23930793-23930815 CTCCACTTCCGCCTTTGGCTAGG - Intergenic
1114958132 14:27849010-27849032 ACTCACTGCCTCCCTTGACTGGG - Intergenic
1115008244 14:28511993-28512015 TCTCACGGCTTCCCTTGGCTGGG + Intergenic
1115391103 14:32856102-32856124 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1115622124 14:35151022-35151044 ACCCATTGCATCATTTGGCTTGG + Intronic
1115717578 14:36123369-36123391 TCCAACTTCCTCCTGTAGCTTGG + Intergenic
1115827591 14:37294508-37294530 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1115974471 14:38981413-38981435 TCTCACAGCTTCCTTTGGCTAGG + Intergenic
1116011588 14:39358496-39358518 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1116312871 14:43347620-43347642 CCGCACTGCCTCCATTGGCTGGG + Intergenic
1116474558 14:45325178-45325200 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1116545952 14:46166075-46166097 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1116704923 14:48284650-48284672 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1116719771 14:48481542-48481564 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1117082521 14:52166608-52166630 TCTCAGTGCCTCCTTGGCCTTGG + Intergenic
1117358562 14:54949202-54949224 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1117416518 14:55501461-55501483 TCTGACTGCCTCCTTTGGAAAGG + Intergenic
1117503193 14:56374593-56374615 ACTCACTGCTTCCCTTGGCTGGG + Intergenic
1117640949 14:57799220-57799242 AATCACTGCTTCCTTTGGCTGGG - Intronic
1117750971 14:58923797-58923819 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1117829039 14:59732523-59732545 ACTCACTGCTTCCCTTGGCTGGG - Intronic
1117945377 14:61014325-61014347 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1118053051 14:62050413-62050435 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1118067041 14:62204048-62204070 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1118146540 14:63143924-63143946 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1118478817 14:66143600-66143622 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1118483241 14:66188671-66188693 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1118558306 14:67050893-67050915 ACTCACTACCTCCCTTGGCTGGG - Intronic
1118793367 14:69116392-69116414 TCCCACTCCTTCCTTTGAATTGG + Exonic
1118923334 14:70169625-70169647 ACTCACTGCCTCATTTGGGTGGG + Intronic
1118958238 14:70502500-70502522 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1119144011 14:72294023-72294045 TCCCACTTGCCCCCTTGGCTAGG - Intronic
1119422210 14:74514056-74514078 TTCCTCTGGCTCCTTTGGATTGG - Intronic
1120084196 14:80250629-80250651 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1120369067 14:83608226-83608248 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1120618962 14:86739391-86739413 TCTGACTGCCTCCTTTGGAGAGG - Intergenic
1120670697 14:87359667-87359689 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1120799053 14:88669093-88669115 ACTCACTGCCTCTCTTGGCTGGG - Intronic
1120963847 14:90150155-90150177 TTCCACTCCCTTCTTTGGCTGGG - Intronic
1121298996 14:92853990-92854012 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1121351648 14:93178179-93178201 TCCCTTTCCCTGCTTTGGCTTGG + Intergenic
1121390322 14:93568011-93568033 TCTGACTGCCTCCTTTGGAAAGG - Intronic
1121706700 14:96001776-96001798 ACTCACCGCCTCCTTTGGCTGGG - Intergenic
1123110428 14:105864552-105864574 TCCTTCTGCCTCCTTTCTCTGGG - Intergenic
1123127684 14:105961064-105961086 TCCAACTTCCTCCTTTAGCTCGG + Intergenic
1202846536 14_GL000009v2_random:182775-182797 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1202915999 14_GL000194v1_random:173377-173399 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1123408151 15:20036874-20036896 TCCAACTTCCTCCTTTAGCTCGG + Intergenic
1123480749 15:20628985-20629007 CCTCACGGCCTCCCTTGGCTAGG - Intergenic
1123517475 15:21043528-21043550 TCCAACTTCCTCCTTTAGCTCGG + Intergenic
1123637261 15:22371382-22371404 CCTCACGGCCTCCCTTGGCTAGG + Intergenic
1123719592 15:23049360-23049382 TCCCACTGGCACCTCTGGCCAGG - Intergenic
1123822474 15:24044376-24044398 TCACACTTCCTCATTTAGCTTGG - Intergenic
1123832677 15:24157232-24157254 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1123885185 15:24719111-24719133 CCTCACTGCCTCCCTTAGCTGGG + Intergenic
1124257766 15:28159673-28159695 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1124343461 15:28904842-28904864 TCCCACTGCCTCGTGTGTCATGG - Intronic
1124569888 15:30853547-30853569 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1124918166 15:33996908-33996930 TCGAACAGCCTCCTTTAGCTGGG - Intronic
1125036373 15:35129118-35129140 TACCAGTGCCTTCTTTTGCTTGG - Intergenic
1125054602 15:35342388-35342410 ACTCACTGCTTCCCTTGGCTAGG + Intronic
1125058463 15:35390783-35390805 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1125354611 15:38803698-38803720 TCTCACGGCTTCCCTTGGCTGGG + Intergenic
1125724397 15:41860930-41860952 TCCAAATGCCTCCCCTGGCTGGG - Intronic
1126497085 15:49303656-49303678 TCCAGCTGCCTCCTTGGCCTTGG + Intronic
1126818582 15:52478307-52478329 TCTCACAGCTTCCCTTGGCTAGG + Intronic
1126889089 15:53184424-53184446 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1126966085 15:54056160-54056182 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1126996357 15:54449716-54449738 TCAAACTTCCTCCTTTAGCTTGG + Intronic
1127452623 15:59131544-59131566 TCTCACGGCTTCCCTTGGCTAGG - Intergenic
1127484095 15:59403482-59403504 TCCCACTGGCACCTTGGTCTTGG + Intronic
1128437414 15:67667569-67667591 TACCTCTTCCTCCTTTGTCTTGG + Intronic
1128677420 15:69621961-69621983 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1128856641 15:71023625-71023647 ACTCAATGCCTCCCTTGGCTGGG - Intronic
1129126704 15:73447907-73447929 TCTCACGGCTTCCCTTGGCTGGG - Intronic
1129567117 15:76634201-76634223 CCTCACTGCCTCCCTTGCCTGGG + Intronic
1129587941 15:76887394-76887416 TGCCACGGCTTCCCTTGGCTAGG - Intronic
1129631098 15:77261322-77261344 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1130030468 15:80308843-80308865 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1130275434 15:82473716-82473738 TTCTACTGCATCCTTTGGCTGGG + Intergenic
1130417836 15:83710739-83710761 GCCCTCTGCCTCCTTTGGGATGG - Intronic
1130432457 15:83861821-83861843 TCGGACTTCCTCCTTTAGCTCGG - Intronic
1130450233 15:84043589-84043611 TCAGACTTCCTCCTTTAGCTTGG - Intergenic
1130467794 15:84201111-84201133 TTCTACTGCATCCTTTGGCTGGG + Intergenic
1130476083 15:84269042-84269064 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1130483503 15:84383096-84383118 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1130485889 15:84398357-84398379 TTCTACTGCATCCTTTGGCTGGG - Intergenic
1130496471 15:84472431-84472453 TTCTACTGCATCCTTTGGCTGGG - Intergenic
1130590086 15:85205709-85205731 TTCTACTGCATCCTTTGGCTGGG + Intergenic
1130764095 15:86852564-86852586 TCCCAATGCCTCTTTTTGCAAGG + Intronic
1130798304 15:87234692-87234714 TCTAACTTCCTCCTTTAGCTCGG + Intergenic
1130802515 15:87280258-87280280 TCTAACTTCCTCCTTTAGCTCGG + Intergenic
1130811024 15:87378413-87378435 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1131555462 15:93394897-93394919 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1131590787 15:93746620-93746642 ACTCACTGCCTCCCTTGGCTAGG - Intergenic
1131595468 15:93793415-93793437 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1132096344 15:98987900-98987922 TCTCACAGCTTCCCTTGGCTGGG - Intronic
1132139617 15:99381473-99381495 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1132216822 15:100068943-100068965 TTCAACTTCCTCCTTTAGCTCGG - Intronic
1132218421 15:100085043-100085065 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1133432536 16:5750760-5750782 TGCCACAGCTTCCCTTGGCTAGG + Intergenic
1133686605 16:8171017-8171039 TCCCACTGTCTCCTCAGACTTGG + Intergenic
1133901337 16:9978082-9978104 TCCAACTGCCTCATTTTGCATGG - Intronic
1133938834 16:10291647-10291669 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1134312791 16:13091740-13091762 TCACACATCCTCCTTTAGCTCGG + Intronic
1134391871 16:13827425-13827447 TTCCACTGTCTCCTTTGGGATGG + Intergenic
1136178529 16:28535141-28535163 TCCCACAGCCCCCTTGGCCTGGG + Intronic
1136731357 16:32416725-32416747 TCCAACATCCTCCTTTAGCTCGG + Intergenic
1137084663 16:36104499-36104521 GCCCATTGCCTCTTTTGTCTGGG + Intergenic
1137224626 16:46491042-46491064 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1137318066 16:47348261-47348283 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1137336544 16:47554743-47554765 CCTCACCGCTTCCTTTGGCTAGG + Intronic
1137360719 16:47812918-47812940 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1137371577 16:47911054-47911076 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1137496586 16:48973887-48973909 TTCCACTCCCTCCTTCAGCTCGG - Intergenic
1137503526 16:49029883-49029905 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1138357264 16:56392414-56392436 TCAAACTTCCTCCTTTAGCTTGG - Intronic
1138470034 16:57227111-57227133 TCCCAGTGCCTCCTTTGTTCAGG - Intronic
1138477974 16:57283434-57283456 TCCCATTGTCTCCTATTGCTGGG - Intronic
1138722442 16:59097602-59097624 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1138882399 16:61031572-61031594 GCTCACCGCCTCCCTTGGCTTGG + Intergenic
1139595438 16:67955076-67955098 GCCCACAGCCTCCTCTGGCTGGG + Intronic
1139614480 16:68080698-68080720 TCAAAATGCCTCCTTTGGCTGGG + Intergenic
1140537173 16:75720303-75720325 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1140539131 16:75739772-75739794 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1140583052 16:76254248-76254270 TCGAACTTCCTCCTTTTGCTCGG + Intergenic
1140670176 16:77269960-77269982 ACTCACTGCCTCCTTTAGCTGGG + Intronic
1140984058 16:80141256-80141278 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1141235041 16:82208702-82208724 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1141650965 16:85392961-85392983 TCTCCCTGCCTCTTTGGGCTCGG + Intergenic
1141682243 16:85551456-85551478 TCCCACTGTCCCTTGTGGCTTGG - Intergenic
1141899269 16:86979792-86979814 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1202995036 16_KI270728v1_random:100546-100568 TCCAACATCCTCCTTTAGCTCGG - Intergenic
1203021723 16_KI270728v1_random:412888-412910 TCCAACATCCTCCTTTAGCTCGG - Intergenic
1143103493 17:4516533-4516555 TCCCACAGCCCCCTGTGCCTGGG - Intronic
1143257697 17:5574007-5574029 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1144448687 17:15355847-15355869 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1145396657 17:22501878-22501900 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1145716717 17:27029785-27029807 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1145929048 17:28671187-28671209 TCCCACTGCCATCTTTAACTGGG + Intronic
1146417164 17:32645844-32645866 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1146463154 17:33064101-33064123 TCACACTTCCTCCTTTAGCTCGG + Intronic
1146720193 17:35118711-35118733 ACCCTCTGCTCCCTTTGGCTTGG + Intronic
1146958563 17:36952662-36952684 TCCCACTAGCTCCTTTTGTTAGG + Intronic
1147714573 17:42496723-42496745 TTCCACAGCCTCCTGTAGCTGGG - Intronic
1149093897 17:52817450-52817472 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
1149229775 17:54519425-54519447 ACTCACTTCCTCCCTTGGCTAGG + Intergenic
1149541695 17:57472444-57472466 TCCCCCTGCCTACTATGGCTAGG - Intronic
1150066183 17:62111361-62111383 AGCCACTGCCTCCTTTCTCTAGG + Intergenic
1150196595 17:63305290-63305312 ACTCACTGCCTACCTTGGCTGGG + Intronic
1151841941 17:76625272-76625294 TCCCACTGTATCCTGTGCCTTGG + Exonic
1152771953 17:82175498-82175520 TCTCACTGCCTCCTTTGGAGAGG + Intronic
1153858538 18:9174577-9174599 ACTCACTGCTTCCCTTGGCTGGG + Intronic
1154163891 18:11999679-11999701 TCCCACTGCGCCCTCTGGCCTGG - Intronic
1155006620 18:21735282-21735304 TCTCACAGCTTCCCTTGGCTTGG - Intronic
1155019996 18:21887887-21887909 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1155498438 18:26464752-26464774 TCCCACTGCCCCCTAAGCCTGGG - Intronic
1155568380 18:27162753-27162775 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1155762793 18:29588413-29588435 GCTCACCGCCTCCTTTGGCTGGG - Intergenic
1156230814 18:35152414-35152436 CCTCACTGCTTCCCTTGGCTAGG + Intergenic
1156280158 18:35628767-35628789 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1156725193 18:40119002-40119024 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1156905212 18:42344424-42344446 TCTCTCTGCCTCCTTTTGTTAGG + Intergenic
1157205624 18:45695649-45695671 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1157286933 18:46383197-46383219 ACCCACTGCCTCCCCTGGGTGGG - Intronic
1157478664 18:48038987-48039009 GCCCACTGCCAGCTTTGGCTAGG - Intronic
1157593610 18:48850779-48850801 TCCCTCAGCCTCCCTTGGATGGG - Intronic
1157631967 18:49107347-49107369 TCAAACTTCCTCCTTTAGCTAGG + Intronic
1157679682 18:49594945-49594967 TGCAAGTGCCTTCTTTGGCTTGG + Exonic
1157935256 18:51864865-51864887 TCTCAGTGCCTCCTTGGCCTTGG - Intergenic
1157947945 18:52002237-52002259 TCCGATTGCCTCCTTTGGAGAGG + Intergenic
1158054213 18:53260144-53260166 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1158095075 18:53761336-53761358 TTCCACTGTCTGCTTTGTCTTGG - Intergenic
1158127064 18:54112279-54112301 TCCCCCTGATTCCTCTGGCTAGG + Intergenic
1158168914 18:54574440-54574462 TCGTACTTCCTCCTTTAGCTCGG + Intergenic
1158647245 18:59257830-59257852 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1158677047 18:59529571-59529593 ACTCACTGCCTCCCTTGGCTGGG + Intronic
1158800732 18:60905570-60905592 TCCCACTCTCATCTTTGGCTGGG - Intergenic
1159761675 18:72434542-72434564 GGCAACTGCCTCCTTTGGATGGG - Intergenic
1160296105 18:77638296-77638318 TCAAACTTCCTCCTTTAGCTAGG - Intergenic
1161273544 19:3403689-3403711 TCCTCCTGCCTCCTTTGGCTGGG + Intronic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1162245760 19:9398856-9398878 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1162524934 19:11201621-11201643 TCCCTCTGCCTCCTCTTTCTGGG + Intronic
1163872033 19:19830167-19830189 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1163886252 19:19967248-19967270 ACTCACTGCCCCCCTTGGCTGGG + Intergenic
1163888212 19:19988236-19988258 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1163940826 19:20491500-20491522 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1163974996 19:20842190-20842212 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1164015719 19:21254515-21254537 TTCCTCTGCTTCCTTTGGTTGGG - Intronic
1164086931 19:21911500-21911522 TCACAATGCCTCCTATGGGTAGG - Intergenic
1164248508 19:23456687-23456709 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1164420653 19:28088834-28088856 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1165287951 19:34858540-34858562 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1166518724 19:43465334-43465356 TCCCTCTGCCTCCCTTGCTTAGG + Intronic
1167688576 19:50971326-50971348 TCCCTCTGCCTCCTCTCTCTGGG + Intergenic
1168159579 19:54500792-54500814 TCCCACTTGCTCCCTGGGCTTGG + Intronic
1168437863 19:56336525-56336547 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1168538929 19:57194201-57194223 TACCACCTTCTCCTTTGGCTGGG - Intronic
925116384 2:1382017-1382039 TGCCAGTGCCTCCTTGGGATTGG - Intronic
925116919 2:1387652-1387674 TCGAACTTCCTCCTTTAGCTTGG + Intronic
925327139 2:3031732-3031754 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
926697435 2:15780542-15780564 TCCCAGTGCCTCATCTGCCTTGG + Intergenic
926917610 2:17908401-17908423 TCGAACTTCCTCCTTTAGCTCGG + Intronic
926925958 2:17988061-17988083 TCAAACTTCCTCCTTTAGCTTGG + Intronic
927058320 2:19388906-19388928 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
927284005 2:21337115-21337137 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
927342859 2:22002249-22002271 TCCCACTTCCTCTTGTGGTTAGG - Intergenic
927596518 2:24402722-24402744 TCTCAGTGCCTCCTTGGCCTTGG + Intergenic
928379561 2:30805870-30805892 TCCCCCTGCCTCCAATAGCTGGG + Intronic
928492318 2:31796511-31796533 TCATACTTCCTCCTTTAGCTCGG - Intergenic
928759035 2:34560256-34560278 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
928837739 2:35567996-35568018 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
929038978 2:37724337-37724359 TCGAACTTCCTCCTTTAGCTCGG - Intronic
929068916 2:38009651-38009673 TCGAACTTCCTCCTTTAGCTCGG + Intronic
929233071 2:39579955-39579977 TCAGACTTCCTCCTTTAGCTCGG + Intergenic
929490820 2:42394627-42394649 TCTGACTGCCTCCTTTGGAGAGG + Intronic
929629758 2:43447372-43447394 TCCCTCTGCCTCCTTTGTATAGG + Intronic
929776809 2:44935193-44935215 TCCCTCTTCCCCCTTTGGCTGGG - Intergenic
930143137 2:47973736-47973758 TATCACAGCCTCCCTTGGCTAGG - Intergenic
930268997 2:49233565-49233587 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
930289981 2:49481532-49481554 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
930318677 2:49827773-49827795 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
930598093 2:53412080-53412102 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
930838042 2:55815203-55815225 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
930922690 2:56776789-56776811 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
931043737 2:58326523-58326545 TCAAACTTCCTCCTTTAGCTGGG - Intergenic
931194303 2:60036048-60036070 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
931212152 2:60207540-60207562 CCTCACTGCTTCCCTTGGCTAGG + Intergenic
931477742 2:62606422-62606444 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
931491573 2:62753934-62753956 TCGAACTTCCTCCTTTAGCTTGG + Intronic
932504380 2:72214547-72214569 TTTCAGTGCCTCTTTTGGCTAGG + Intronic
932649491 2:73539575-73539597 TCGAACTTCCTCCTTTAGCTCGG - Intronic
933023197 2:77220406-77220428 TCGAACTTCCTCCTTTAGCTCGG - Intronic
933129409 2:78654752-78654774 ACTCACTGCCTCTCTTGGCTGGG - Intergenic
933237660 2:79882914-79882936 ACTCACTGCCTTCCTTGGCTGGG + Intronic
933257481 2:80097947-80097969 TCGAACTTCCTCCTTTAGCTCGG + Intronic
933324177 2:80815032-80815054 CCTCACTGCTTCCCTTGGCTGGG - Intergenic
933404505 2:81841124-81841146 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
933447671 2:82402938-82402960 TCTCAGTGCCTCCTTGGCCTTGG + Intergenic
933603107 2:84353853-84353875 TCTCACAGCTTCCGTTGGCTAGG - Intergenic
933618535 2:84510515-84510537 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
933801666 2:85964983-85965005 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
934299436 2:91768483-91768505 TCCCCCTGCTTCCGTTGCCTGGG + Intergenic
934898421 2:98138865-98138887 TCTCAGTGCCTCCTCTGCCTGGG + Intronic
935118157 2:100156602-100156624 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
935369094 2:102325552-102325574 TCGAACTTCCTCCTTTAGCTCGG - Intronic
935399368 2:102644245-102644267 CCTCACAGCGTCCTTTGGCTAGG - Intronic
935450350 2:103201737-103201759 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
935455452 2:103262348-103262370 CCCCACTGCCATCTTTGGTTGGG - Intergenic
935858216 2:107298764-107298786 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
936172969 2:110192207-110192229 TCGAACTTCCTCCTTTAGCTCGG - Intronic
936410674 2:112255166-112255188 TCTCCCTGCCTCCTTCGCCTCGG + Intergenic
936762539 2:115804372-115804394 TCGAACTTCCTCCTTTAGCTCGG + Intronic
936806316 2:116336745-116336767 TCGCACATCCTCCTTTAGCTCGG + Intergenic
937063950 2:119003275-119003297 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
937075008 2:119096899-119096921 TCGAACATCCTCCTTTGGCTTGG - Intergenic
937229327 2:120388410-120388432 TCCCAGAGCACCCTTTGGCTAGG + Intergenic
937894050 2:126963820-126963842 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
937984582 2:127632804-127632826 CCCTCCTGCCTCCTCTGGCTTGG + Intronic
938126154 2:128672622-128672644 TCTCAGTGCCTCCTCTGCCTGGG - Intergenic
938147659 2:128850145-128850167 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
938167386 2:129043085-129043107 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
938711023 2:133976320-133976342 TCCCCTTGCCTCCATGGGCTGGG - Intergenic
939074777 2:137587277-137587299 TCAAACTTCCTCCTTTAGCTCGG + Intronic
939109648 2:137992029-137992051 ACCCATTGCCTCCCTTGGCTGGG - Intronic
939364894 2:141219002-141219024 ACTCACTGCCTCCCTTGTCTGGG - Intronic
939391045 2:141570336-141570358 ACTCACTGCCTCCCTTGGCTAGG - Intronic
939398303 2:141660241-141660263 ACTCACCGCCTCCCTTGGCTGGG - Intronic
939600651 2:144185714-144185736 TCCAATTGCCTTCCTTGGCTTGG - Intronic
939807337 2:146789587-146789609 TCGAACTCCCTCCTTTAGCTCGG - Intergenic
940080467 2:149795552-149795574 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
940167593 2:150792644-150792666 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
940370493 2:152895792-152895814 CTTCACTGCTTCCTTTGGCTAGG - Intergenic
940809282 2:158224020-158224042 TCGAACTTCCTCCTTTAGCTCGG - Intronic
940827833 2:158433718-158433740 TGTCACAGCTTCCTTTGGCTAGG - Intronic
940891648 2:159041687-159041709 TGCCACGGCTTCCCTTGGCTAGG + Intronic
940892390 2:159047548-159047570 TCTCATTGCCTCCTTTGGAAAGG + Intronic
941682402 2:168413270-168413292 CCTCACAGCCTCCCTTGGCTAGG + Intergenic
941776652 2:169400366-169400388 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
941845221 2:170125815-170125837 TCTCACAGCTTCCTTTGGGTTGG - Intergenic
941895718 2:170627492-170627514 TCGAACTTCCTCCTTTAGCTCGG + Intronic
941896205 2:170631100-170631122 TCGAACTTCCTCCTTTAGCTCGG - Intronic
942000899 2:171646219-171646241 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
942072510 2:172328697-172328719 TCACATTGCCTTCTTTGCCTTGG + Intergenic
942376178 2:175340007-175340029 ACTCACTGCCTCCCTTGGCTAGG + Intergenic
943125258 2:183788856-183788878 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
943250829 2:185519125-185519147 ACTCAATGCCTCCCTTGGCTGGG + Intergenic
943310068 2:186313960-186313982 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
943350652 2:186792928-186792950 CCTCACAGCTTCCTTTGGCTAGG - Intergenic
943866535 2:192931063-192931085 TGTCACAGCTTCCTTTGGCTAGG + Intergenic
943935114 2:193905078-193905100 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
944164963 2:196709444-196709466 TCGAACATCCTCCTTTGGCTCGG + Intronic
944167981 2:196743311-196743333 ACTCACTGCTTCCCTTGGCTGGG + Intronic
944196904 2:197063503-197063525 TCGAACTTCCTCCTTTAGCTGGG - Intronic
944307831 2:198197431-198197453 TCGCACTTCCTCCTTTAGCTCGG - Intronic
944351986 2:198739325-198739347 TCCCACTCCCTCTTTTACCTTGG - Intergenic
944439464 2:199727488-199727510 ACCCACCACCTCCTTTAGCTGGG + Intergenic
944539205 2:200740565-200740587 TCCCACTGGCTTCTTTGGATGGG - Intergenic
944570061 2:201035543-201035565 TCGAACTTCCTCCTTTAGCTCGG + Intronic
944606843 2:201359417-201359439 TCTCACTCGCTCCCTTGGCTTGG - Intergenic
945329788 2:208525751-208525773 TCTCATGGCTTCCTTTGGCTAGG + Intronic
945439828 2:209865057-209865079 ACTCACTGCCTCCCTTGGCTTGG + Intronic
945495907 2:210506577-210506599 TCGAACTTCCTCCTTTAGCTTGG - Intronic
945524004 2:210866077-210866099 CCTCACTGCCTCCTTTGGCTGGG - Intergenic
945652770 2:212585334-212585356 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
945714016 2:213336107-213336129 CCTCACCGCCTCCTTTGGCTGGG - Intronic
945873639 2:215254155-215254177 TCGTACTTCCTCCTTTAGCTCGG - Intergenic
946762942 2:223013057-223013079 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
947085981 2:226453840-226453862 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
947242116 2:228006481-228006503 TCAAACTTCCTCCTTTAGCTCGG + Intronic
947993303 2:234504562-234504584 TCCCTTTGCCTCCTTTGCTTAGG - Intergenic
948949084 2:241237200-241237222 TCCCACTGCCTCTCCTGGGTGGG - Intronic
948955393 2:241286408-241286430 TCTGACTGCCTCCTTTGGAGAGG + Intronic
949028849 2:241778910-241778932 TCTGACTGCCTCCTTTGGAGAGG - Intronic
949030293 2:241792887-241792909 TCTGACTGCCTCCTTTGGAGAGG + Intronic
949060790 2:241955989-241956011 TCTGACTGCCTCCTTTGGAGAGG - Intergenic
1168933604 20:1644770-1644792 ACTCACCGCCTCCCTTGGCTGGG + Intronic
1169321552 20:4637072-4637094 TCCCTAAGCCTCCTTTGCCTTGG + Intergenic
1169695854 20:8385730-8385752 ACTCGCTGCCTCCCTTGGCTGGG + Intronic
1169795805 20:9461498-9461520 TGTCACGGCTTCCTTTGGCTAGG - Intronic
1170496525 20:16930575-16930597 ACTCACTACCTCCCTTGGCTGGG - Intergenic
1170543367 20:17411270-17411292 TGTCACGGCTTCCTTTGGCTAGG - Intronic
1170707671 20:18760176-18760198 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1171434058 20:25105477-25105499 TGTCACGGCTTCCTTTGGCTAGG - Intergenic
1171441326 20:25165851-25165873 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1171443546 20:25186754-25186776 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
1171513469 20:25706935-25706957 TCTCATGGCTTCCTTTGGCTAGG + Intergenic
1171514007 20:25713450-25713472 TCCAACATCCTCCTTTAGCTTGG + Intergenic
1172947323 20:38699668-38699690 TCCACCTGCCTCCTTGGGCTTGG - Intergenic
1173301286 20:41806205-41806227 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1174953398 20:55067523-55067545 ACTCACTGCCTCCTTTGGCTGGG + Intergenic
1175646098 20:60673131-60673153 TCTGACTGCCTCCTTTGGAGAGG - Intergenic
1176635353 21:9188023-9188045 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1176638022 21:9267108-9267130 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1176738431 21:10574711-10574733 ACTCACTGCTTCCCTTGGCTGGG - Intronic
1176942232 21:14938784-14938806 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1177129607 21:17240386-17240408 TCTCATTGCTTCCCTTGGCTAGG - Intergenic
1177956668 21:27606602-27606624 ACTCACCGCCTCCTTTGACTGGG + Intergenic
1178033408 21:28554654-28554676 CCTCACTGCTTCCCTTGGCTTGG - Intergenic
1178345204 21:31820119-31820141 TGCCACAGCTTCCCTTGGCTAGG + Intergenic
1178597692 21:33969608-33969630 TCCCACTGCTTCCCTGGCCTGGG + Intergenic
1178965244 21:37110258-37110280 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1179025101 21:37673343-37673365 TCCTGCAGCTTCCTTTGGCTGGG + Intronic
1179666509 21:42916502-42916524 TCTCATTGCCTCCTTTGGAAAGG + Intergenic
1180225953 21:46392534-46392556 TCTCACTGCCTTCGTTGGGTTGG + Intronic
1180250422 21:46582530-46582552 AGTCACTGCCTCCCTTGGCTGGG + Intergenic
1180306523 22:11131169-11131191 TGCCACAGCTTCCCTTGGCTAGG - Intergenic
1180414750 22:12698437-12698459 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1180422061 22:12874605-12874627 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1180541123 22:16448416-16448438 TCCAACATCCTCCTTTAGCTTGG - Intergenic
1180545042 22:16493352-16493374 TGCCACAGCTTCCCTTGGCTAGG - Intergenic
1180854858 22:19039315-19039337 ACCTACTGCCCCCTGTGGCTGGG + Intronic
1180991991 22:19942285-19942307 TCCCACTTGGTCCTTGGGCTGGG + Intronic
1181342063 22:22189027-22189049 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1181697790 22:24602585-24602607 TCCCCCTGCTTCCGTTGCCTGGG + Intronic
1181875132 22:25934743-25934765 TCTGACTGCCTCCTTTGGAAAGG - Intronic
1182939012 22:34255648-34255670 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1182993396 22:34789890-34789912 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1183948500 22:41339947-41339969 GCCCCCCGCCTCCTTCGGCTTGG + Exonic
1184576797 22:45375151-45375173 TCTGACTGCCTCCTTTGGAGAGG + Intronic
1184886644 22:47350484-47350506 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1185121297 22:48973235-48973257 TCCCACTGCCTCCCTTGCCCAGG - Intergenic
1185406187 22:50652820-50652842 TCTGACTGCCTCCTTTGGAGAGG + Intergenic
949120020 3:373811-373833 ACTCACCGCCTCCCTTGGCTGGG + Intronic
949224960 3:1682845-1682867 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
949342638 3:3045828-3045850 TCGAACTTCCTCCTTTAGCTCGG - Intronic
949365549 3:3276684-3276706 TAACACTGCCTCCTTTCCCTTGG + Intergenic
949443545 3:4109866-4109888 TCAAACTTCCTCCTTTAGCTCGG + Intronic
949641097 3:6036612-6036634 TCTCACGGCTTCCCTTGGCTAGG + Intergenic
949944396 3:9178697-9178719 TCCCAATGCCTCCCATGGCCTGG + Intronic
950445839 3:13037315-13037337 TGCCCCTGCCTCCTTGTGCTTGG - Intronic
950631788 3:14286847-14286869 TTCCACTCTCTCCTTTGGTTAGG - Intergenic
950835080 3:15912179-15912201 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
950995853 3:17494985-17495007 ACTCACTGCCTCCCCTGGCTGGG + Intronic
951020933 3:17780071-17780093 TCTCTCTGACTCCTTTGTCTCGG - Intronic
951137164 3:19117872-19117894 ACTCACTTCCTCCCTTGGCTGGG - Intergenic
951286500 3:20820340-20820362 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
951330866 3:21366039-21366061 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
951804671 3:26631228-26631250 TCCCAGTGGCCCCCTTGGCTAGG + Intronic
951964627 3:28369100-28369122 TCGAACTTCCTCCTTTAGCTCGG + Intronic
952319598 3:32263650-32263672 TCGAACTTCCTCCTTTAGCTCGG - Intronic
952503870 3:33989664-33989686 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
952572222 3:34731507-34731529 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
952667883 3:35929355-35929377 CCTCACTTCCTCCTTTAGCTTGG + Intergenic
952679562 3:36074856-36074878 ACTCACTGCCTCCCTTGGCAGGG + Intergenic
953516074 3:43592805-43592827 TCCAACATCCTCCTTTAGCTCGG - Intronic
953524839 3:43680136-43680158 TCGAACTTCCTCCTTTAGCTCGG - Intronic
954613734 3:51959197-51959219 TCCCCCTGCCTCCTTGTGCAGGG + Intronic
955118983 3:56036686-56036708 ACTCACTGCCTCCCTTGTCTGGG - Intronic
955135578 3:56214193-56214215 TCGAACTTCCTCCTTTAGCTCGG - Intronic
955281581 3:57599254-57599276 TCTGACTGCCTCCTTTGGAGAGG - Intergenic
955439687 3:58942488-58942510 CCTCACGGCTTCCTTTGGCTAGG - Intronic
955504248 3:59615026-59615048 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
955652434 3:61209753-61209775 TCGAACTTCCTCCTTTAGCTCGG + Intronic
955669881 3:61392288-61392310 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
955867727 3:63402604-63402626 TCCCACTGCTTCCTTCATCTTGG - Intronic
956207289 3:66768603-66768625 TCGAACTTCCTCCTTTAGCTGGG + Intergenic
956448176 3:69346032-69346054 TCAAACTTCCTCCTTTAGCTTGG - Intronic
956569707 3:70680614-70680636 TCCAACTTCCTCCTTTAGCTCGG + Intergenic
956579650 3:70796346-70796368 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
957291258 3:78281224-78281246 ATTCACTGCCTCCCTTGGCTGGG - Intergenic
957565527 3:81879311-81879333 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
957584419 3:82115085-82115107 ACTCACTGCCTCCCTTGGCTAGG + Intergenic
957604031 3:82375239-82375261 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
957690247 3:83556882-83556904 ACTCACTGCCACCCTTGGCTGGG + Intergenic
957727628 3:84087822-84087844 TTGCACTTCCTCCTTTAGCTCGG - Intergenic
957811622 3:85229357-85229379 TCTCACGGCTTCCCTTGGCTAGG + Intronic
957886820 3:86298219-86298241 TCCAACTTCCTCCTTTAGCTCGG - Intergenic
957942097 3:87018293-87018315 TCGAACTTCCTCCTTTAGCTAGG - Intergenic
958037895 3:88191351-88191373 TCTGACTGCCTCCTTTGGAGAGG - Intergenic
958081093 3:88747128-88747150 TCCCACAGCATCCCTTGGCTAGG - Intergenic
958166522 3:89884371-89884393 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
958167885 3:89900590-89900612 TCACACTTCCTCCTTTAGCTTGG - Intergenic
958185056 3:90109934-90109956 TCTAACTTCCTCCTTTAGCTTGG + Intergenic
958255375 3:91319572-91319594 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
958482927 3:94667128-94667150 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
958569543 3:95861573-95861595 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
958861596 3:99451226-99451248 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
958978122 3:100690315-100690337 TCGAACTTCCTCCTTTAGCTTGG + Intronic
959031179 3:101300607-101300629 ACTCACTGCCTCCCTTGGCTGGG + Intronic
959043768 3:101448926-101448948 TCGAACTTCCTCCTTTAGCTCGG - Intronic
959418450 3:106104752-106104774 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
959642466 3:108656691-108656713 TCGAACTTCCTCCTTTAGCTCGG - Intronic
959692896 3:109218809-109218831 TGTCACAGCTTCCTTTGGCTAGG - Intergenic
959694433 3:109234306-109234328 ACCCATTGCCTCCCTTGGCTGGG - Intergenic
959736453 3:109664958-109664980 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
959883607 3:111474036-111474058 ACTCACAGCCTCCCTTGGCTGGG + Intronic
959953828 3:112212406-112212428 TCGAACTTCCTCCTTTAGCTCGG - Intronic
959955942 3:112238398-112238420 TCGAACTTCCTCCTTTAGCTTGG + Intronic
960016995 3:112902580-112902602 ACTCACTGCCTCCCTTGGCTCGG + Intergenic
960413647 3:117358660-117358682 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
960477341 3:118145342-118145364 ACTCACAGCCTCCCTTGGCTGGG + Intergenic
960565258 3:119125840-119125862 ACTCACCGCCTCCCTTGGCTGGG - Intronic
960763100 3:121095727-121095749 TCGAACTTCCTCCTTTAGCTCGG + Intronic
961033805 3:123628604-123628626 TCCCACTGCTCCCTTTCCCTGGG + Intronic
961958889 3:130833004-130833026 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
962073238 3:132053776-132053798 TCGAACTTCCTCCTTTAGCTTGG + Intronic
962137154 3:132747076-132747098 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
962178006 3:133174876-133174898 TCAAACTTCCTCCTTTAGCTCGG - Intronic
962180262 3:133199228-133199250 TCGAACTTCCTCCTTTAGCTCGG + Intronic
962460296 3:135605415-135605437 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
962602691 3:137006709-137006731 TCCAACATCCTCCTTTAGCTTGG + Intronic
962690965 3:137897792-137897814 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
962691839 3:137907182-137907204 ACTCACTGCCTCCCTTTGCTGGG - Intergenic
962761491 3:138518882-138518904 TCAAACTTCCTCCTTTAGCTCGG - Intronic
962766945 3:138574182-138574204 TGTCACGGCTTCCTTTGGCTAGG - Intronic
962836645 3:139195588-139195610 TCGAACTTCCTCCTTTAGCTCGG + Intronic
962998643 3:140655790-140655812 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
963050613 3:141140275-141140297 TCAAACTTCCTCCTTTAGCTTGG + Intronic
963191642 3:142480028-142480050 TCCAACTTCCTCCTTTAGCTCGG + Intronic
963281849 3:143391651-143391673 TCAAACTTCCTCCTTTAGCTCGG - Intronic
963387823 3:144619565-144619587 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
963461325 3:145617697-145617719 ACTCACTGCCTCCTTTGGCTGGG + Intergenic
963531507 3:146477326-146477348 TCTCACGGCTTCCCTTGGCTAGG - Intronic
963567264 3:146945616-146945638 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
963678861 3:148348454-148348476 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
963825273 3:149946117-149946139 TCGCACTTCCTCCTTTAGCTCGG - Intronic
964006586 3:151836382-151836404 TCCCACTGCTTCCTTTTGACGGG - Intergenic
964156022 3:153585170-153585192 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
964175743 3:153824530-153824552 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
964219089 3:154324097-154324119 TCCCGCTGCCCCCTTTTTCTTGG - Intronic
964228817 3:154438514-154438536 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
964243301 3:154620560-154620582 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
964376191 3:156051640-156051662 TCTCAGTGCCTCCTTGGCCTTGG + Intronic
964532844 3:157686392-157686414 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
964694533 3:159492301-159492323 TCGAACTTCCTCCTTTAGCTTGG - Intronic
964696162 3:159510409-159510431 TCGAACTTCCTCCTTTAGCTCGG + Intronic
965253272 3:166369441-166369463 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
965271183 3:166618623-166618645 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
965288868 3:166850075-166850097 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
965518227 3:169645339-169645361 TCCCATTGCTTCCTTTGCATGGG + Intronic
965754296 3:172009585-172009607 TCCCACGGCCTTCCTTGTCTTGG + Intergenic
966136699 3:176706738-176706760 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
966454687 3:180101946-180101968 ACTCACTGCTTCCCTTGGCTCGG - Intergenic
966539708 3:181075548-181075570 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
966652449 3:182315900-182315922 CCTTACTGCCTCCCTTGGCTGGG + Intergenic
966932592 3:184685465-184685487 ACCCACTGCCTGCTTTATCTGGG - Intergenic
967397731 3:189025299-189025321 ACTCACTGCCTCCCTTGGCTTGG + Intronic
967797073 3:193609978-193610000 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1202748873 3_GL000221v1_random:137913-137935 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
968800664 4:2741539-2741561 TCCCACTGACCCCCTTGTCTTGG + Intergenic
968966953 4:3773590-3773612 TCCCACTTCCTGCTCTGGCTTGG + Intergenic
969049254 4:4360989-4361011 TCTGACTGCCTCCTTTGGAGGGG + Intronic
969159735 4:5246514-5246536 TCAAACTTCCTCCTTTAGCTCGG + Intronic
969187230 4:5485528-5485550 TCAAACTTCCTCCTTTAGCTCGG + Intronic
969357459 4:6638660-6638682 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
969483747 4:7460208-7460230 TACCACTGCCTCATTTCCCTTGG - Intronic
969554517 4:7897136-7897158 TCCAACTGCCTTCTTTGGGTAGG + Intronic
969655048 4:8491907-8491929 TCTCAGTGCCTCCTCTGCCTGGG - Intronic
969952766 4:10854667-10854689 ACTCACTGCTTCCCTTGGCTGGG + Intergenic
970154772 4:13130835-13130857 ACTCACTGCCTCCCTTGGCTCGG - Intergenic
970689106 4:18602068-18602090 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
971275959 4:25197065-25197087 TCCCTCTGGCCCCATTGGCTGGG - Intronic
971438560 4:26654815-26654837 TCGAACTTCCTCCTTTAGCTCGG + Intronic
971586192 4:28407983-28408005 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
971946733 4:33288012-33288034 TCCCTCTGCCTCCTTTTATTAGG + Intergenic
972455265 4:39247555-39247577 TCGAACTTCCTCCTTTAGCTTGG - Intronic
972677545 4:41275361-41275383 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
972764602 4:42140926-42140948 CCCCACTGCCCTCTTTAGCTGGG - Intronic
972864335 4:43211909-43211931 ATCCACTGCTTCCTTGGGCTGGG + Intergenic
972942520 4:44214261-44214283 TCCTCCTAGCTCCTTTGGCTGGG - Intronic
973055466 4:45652370-45652392 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
973546645 4:51989348-51989370 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
973592123 4:52453128-52453150 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
973592888 4:52460152-52460174 TCAAACTTCCTCCTTTGGCTCGG - Intergenic
973648266 4:52971217-52971239 TCAAACTTCCTCCTTTTGCTCGG - Intronic
974090127 4:57302329-57302351 TCATACTTCCTCCTTTGACTTGG + Intergenic
974119706 4:57624268-57624290 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
974130108 4:57744021-57744043 TCCCACTGCTTGCTTTTGCTAGG + Intergenic
974147638 4:57967056-57967078 TCTCAGTGCCTCCTTGGCCTTGG + Intergenic
974196805 4:58585515-58585537 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
974276299 4:59724645-59724667 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
974347179 4:60697021-60697043 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
974499616 4:62683760-62683782 ACTCACCGCCTCCTTTGGCTGGG - Intergenic
974723410 4:65771081-65771103 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
974760274 4:66265991-66266013 ACTCACTGCCTCCCTTGGCCAGG - Intergenic
974913384 4:68149558-68149580 ACTCACTGCCTCCTTTGGCTGGG + Intergenic
975150269 4:71012964-71012986 TCGAACTTCCTCCTTTAGCTCGG - Intronic
975153302 4:71044283-71044305 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
975157573 4:71089338-71089360 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
975165784 4:71176379-71176401 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
975213030 4:71722898-71722920 CCTCATTGCTTCCTTTGGCTAGG + Intergenic
975287355 4:72636284-72636306 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
975679893 4:76866479-76866501 ACTTACTGCTTCCTTTGGCTAGG - Intergenic
975806407 4:78117771-78117793 TCGAACTTCCTCCTTTAGCTCGG + Intronic
975813551 4:78194713-78194735 TCAAACTTCCTCCTTTAGCTCGG + Intronic
975820622 4:78267166-78267188 TCCTCCTGCCTCTGTTGGCTTGG + Intronic
975887298 4:78981385-78981407 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
975998135 4:80340221-80340243 ACTCACAGCTTCCTTTGGCTGGG - Intronic
976289152 4:83399091-83399113 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
976433317 4:84988414-84988436 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
976682286 4:87770270-87770292 TCTAACTTCCTCCTTTAGCTCGG - Intergenic
976837364 4:89390394-89390416 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
976918616 4:90408832-90408854 TCGAACTTCCTCCTTTAGCTTGG - Intronic
976924839 4:90484313-90484335 TCGAACTTCCTCCTTTAGCTCGG + Intronic
976925711 4:90492964-90492986 TCGAACTTCCTCCTTTAGCTCGG - Intronic
976956970 4:90912688-90912710 TCGAACTTCCTCCTTTAGCTTGG - Intronic
976992353 4:91382602-91382624 TGCCACAGCTTCCCTTGGCTAGG + Intronic
977060840 4:92255233-92255255 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
977110195 4:92943520-92943542 TCGAACTTCCTCCTTTAGCTCGG + Intronic
977203883 4:94148429-94148451 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
977218723 4:94314080-94314102 TCAAACTTCCTCCTTTAGCTCGG + Intronic
977343794 4:95792561-95792583 TCGAACTTCCTCCTTTAGCTGGG - Intergenic
977456852 4:97272353-97272375 TCGAACTTCCTCCTTTAGCTTGG - Intronic
977461941 4:97337008-97337030 ACTCACTGCCTCCCTTGGCTGGG - Intronic
977524436 4:98126468-98126490 ACTCACTGCCTCCTTTGGCTAGG + Intronic
977624499 4:99175663-99175685 TCCAACATCCTCCTTTAGCTTGG + Intergenic
977680877 4:99797574-99797596 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
977843874 4:101743835-101743857 TCGAACTTCCTCCTTTAGCTCGG + Intronic
977897310 4:102379693-102379715 TCGAACTTCCTCCTTTAGCTTGG + Intronic
977946583 4:102920611-102920633 TCCAACATCCTCCTTTAGCTCGG - Intronic
977950972 4:102969689-102969711 TCGAACATCCTCCTTTGGCTCGG - Intronic
978140420 4:105312181-105312203 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
978565595 4:110077789-110077811 TCGAACTTCCTCCTTTAGCTCGG - Intronic
978658862 4:111099581-111099603 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
978773205 4:112479518-112479540 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
978783000 4:112576478-112576500 TCAAACTTCCTCCTTTAGCTGGG - Intronic
979042233 4:115812859-115812881 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
979177725 4:117685091-117685113 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
979197912 4:117942000-117942022 AGTCACTGCCTCCCTTGGCTGGG + Intergenic
979582012 4:122371739-122371761 CCCCACTCACTCCCTTGGCTTGG + Intergenic
979732893 4:124045742-124045764 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
979739369 4:124130756-124130778 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
979775371 4:124583052-124583074 ACTCACTGCCTCCCTTGGCTTGG - Intergenic
979878850 4:125928862-125928884 AGCCACTGCCACCTCTGGCTAGG - Intergenic
979886225 4:126030930-126030952 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
979999807 4:127473866-127473888 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
980090298 4:128436444-128436466 TCTAACTTCCTCCTTTAGCTCGG + Intergenic
980205994 4:129720425-129720447 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
980231414 4:130051142-130051164 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
980413836 4:132458968-132458990 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
980587060 4:134830849-134830871 TCCAACTTCCTCCTTTGGCTTGG - Intergenic
980607428 4:135111199-135111221 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
980744733 4:136999684-136999706 ACTCACTGCCTCCCTTGCCTGGG + Intergenic
981096473 4:140787652-140787674 TCAAACTTCCTCCTTTAGCTGGG + Intergenic
981100551 4:140825277-140825299 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
981188607 4:141834804-141834826 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
981338432 4:143593176-143593198 TCGAACTTCCTCCTTTAGCTTGG + Intronic
981345574 4:143673033-143673055 TCGAACTTCCTCCTTTAGCTCGG + Intronic
981494729 4:145378623-145378645 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
981939863 4:150271122-150271144 CCTCACAGCCTCCATTGGCTGGG - Intronic
982372237 4:154646944-154646966 ACTCACCGCCTCCCTTGGCTGGG - Intronic
982390527 4:154858358-154858380 ACCCACAACCTCCCTTGGCTTGG - Intergenic
982397360 4:154926482-154926504 ACTCACTGCTTCCTTTGGTTGGG + Intergenic
982405946 4:155020716-155020738 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
982452858 4:155573098-155573120 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
982620050 4:157692682-157692704 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
982625741 4:157764029-157764051 TCACACTGCCTCTTTTGTTTTGG + Intergenic
982785701 4:159533955-159533977 TGCCACGGCTTCCCTTGGCTAGG + Intergenic
982820051 4:159934013-159934035 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
983108856 4:163723965-163723987 TCAAACTTCCTCCTTTAGCTCGG + Intronic
983364531 4:166769128-166769150 TCAAACTTCCTCCTTTAGCTCGG + Intronic
983682002 4:170363775-170363797 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
983761228 4:171408906-171408928 TCCGATTGCCTCCTTTGGAGAGG + Intergenic
983820869 4:172192595-172192617 ACTCACTACCTCCCTTGGCTGGG - Intronic
983843252 4:172482370-172482392 TCTCAGCGCCTCCTTGGGCTCGG - Intronic
983963934 4:173787093-173787115 TCGAACTTCCTCCTTTAGCTGGG - Intergenic
984215682 4:176910596-176910618 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
984372398 4:178884140-178884162 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
984438092 4:179729123-179729145 ACGCACTGCCTCCTTTTTCTAGG - Intergenic
984626202 4:182009917-182009939 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
985010698 4:185579622-185579644 TACCACTGACTGTTTTGGCTAGG + Intergenic
1202752919 4_GL000008v2_random:25525-25547 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG + Intergenic
986011972 5:3724851-3724873 ACCCACCGCCGCCCTTGGCTTGG + Intergenic
986098776 5:4586140-4586162 GCCCACTGCCTGCCTAGGCTAGG - Intergenic
986920586 5:12674494-12674516 TCTCACGGCTTCCCTTGGCTAGG + Intergenic
986988031 5:13521215-13521237 TCTGACTGCCTCCTTTGGAAAGG + Intergenic
987111140 5:14688200-14688222 TTCCACTGTCTCCTCTGGGTTGG + Intronic
987662607 5:20895959-20895981 TCCCATTCCTTCATTTGGCTTGG + Intergenic
987834779 5:23146634-23146656 AGTCACTGCCTCCTTTGGCTCGG + Intergenic
987837985 5:23186367-23186389 TGTCACGGCTTCCTTTGGCTAGG - Intergenic
988186507 5:27870996-27871018 ACTCACTGCCTCTCTTGGCTGGG - Intergenic
988416156 5:30948935-30948957 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
988618146 5:32794922-32794944 CCTCACAGCTTCCTTTGGCTAGG - Intergenic
988668283 5:33354059-33354081 TGCCACGGCTTCCCTTGGCTAGG + Intergenic
988795136 5:34646604-34646626 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
988945095 5:36189166-36189188 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
988945232 5:36190115-36190137 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
989248462 5:39280680-39280702 TCTAACTTCCTCCTTTAGCTCGG + Intergenic
989402501 5:41023242-41023264 TCGAACTTCCTCCTTTAGCTCGG - Intronic
989513523 5:42316067-42316089 TCAGACTGCCTCCTTTGGAAAGG + Intergenic
989616541 5:43341951-43341973 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
989623102 5:43403710-43403732 TCGAACTTCCTCCTTTAGCTCGG - Intronic
989649527 5:43672225-43672247 TCAAACTTCCTCCTTTAGCTTGG + Intronic
989676770 5:43981941-43981963 ACTCATTGCCTCCCTTGGCTGGG + Intergenic
989684118 5:44064821-44064843 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
989784742 5:45313567-45313589 TTGCACTTCCTCCTTTAGCTTGG - Intronic
989843524 5:46111157-46111179 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
989956638 5:50367952-50367974 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
989965756 5:50464877-50464899 TCTCAGTGCCTCCTCTGACTGGG + Intergenic
989977182 5:50601059-50601081 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
990071637 5:51790092-51790114 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
990084088 5:51952929-51952951 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
990142228 5:52718944-52718966 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
990188018 5:53229075-53229097 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
990226830 5:53664772-53664794 TCAAACTTCCTCCTTTAGCTCGG + Intronic
990366857 5:55080303-55080325 TCAAACTTCCTCCTTTAGCTAGG + Intergenic
990482140 5:56221591-56221613 TGTCACTGCTTCCCTTGGCTAGG - Intronic
990678742 5:58217093-58217115 TCATACTTCCTCCTTTAGCTCGG - Intergenic
990692207 5:58376804-58376826 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
990721381 5:58699866-58699888 TGTCACTGCTTCCCTTGGCTAGG + Intronic
991043245 5:62196706-62196728 TCTCAGTGCCTCCTTTGGAAAGG - Intergenic
991053044 5:62292723-62292745 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
991227860 5:64293188-64293210 ACTCACTGCTTCCCTTGGCTTGG + Intronic
991417260 5:66405583-66405605 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
991496220 5:67229122-67229144 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
991529820 5:67603266-67603288 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
991535498 5:67665776-67665798 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
991535632 5:67666727-67666749 TGTCACTGCTTCCTTTGTCTAGG + Intergenic
991656108 5:68905311-68905333 TCCCAAGCCCTCCTTTTGCTGGG - Intergenic
992016336 5:72578499-72578521 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
992254951 5:74911995-74912017 TCTCACGGCTTCCCTTGGCTGGG + Intergenic
992281047 5:75176933-75176955 TTGCACTTCCTCCTTTAGCTCGG - Intronic
992634183 5:78710936-78710958 TCAAACTTCCTCCTTTAGCTCGG - Intronic
992647291 5:78823291-78823313 TCCCAGTGACTACTTTGGCCTGG + Intronic
992659413 5:78944219-78944241 TCGAACTTCCTCCTTTAGCTCGG + Intronic
992726514 5:79612652-79612674 CACCACTACCTCCTTTGGTTCGG + Exonic
993370432 5:87085603-87085625 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
993438328 5:87924881-87924903 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
993610185 5:90044473-90044495 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
993619204 5:90147946-90147968 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
993742364 5:91556571-91556593 TCGAACATCCTCCTTTGGCTCGG - Intergenic
994138025 5:96309679-96309701 TCTCACAGCTTCCTTTGGGTAGG + Intergenic
994230457 5:97305910-97305932 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
994266466 5:97722722-97722744 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
994344081 5:98664419-98664441 ACTCACTACCTCCCTTGGCTGGG - Intergenic
994499764 5:100559889-100559911 TCGAACTTCCTCCTTTAGCTCGG + Intronic
994507029 5:100656626-100656648 TCTCAGTGCCTCCTCTGACTGGG + Intergenic
994565737 5:101443233-101443255 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
994847133 5:105003760-105003782 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
995041816 5:107596708-107596730 TCCATCTACCTCCTTTTGCTGGG - Intronic
995204034 5:109458440-109458462 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
995329958 5:110935165-110935187 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
995338605 5:111030917-111030939 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
995568598 5:113457007-113457029 TCTCACCGCCTCCTCTGCCTGGG + Intronic
995579078 5:113574952-113574974 ACTCACTGCTTCCCTTGGCTGGG + Intronic
995594294 5:113731419-113731441 ACTCACTGCCTCACTTGGCTGGG + Intergenic
995666105 5:114544472-114544494 CCTCACTGCCTCCCTTGGCTGGG - Intergenic
995695671 5:114876109-114876131 TCTCACGGCTTCCTTTGGCTAGG - Intergenic
995785803 5:115826127-115826149 CCTCACAGCCTCCTTTGGCTGGG + Intergenic
995905355 5:117116732-117116754 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
995960231 5:117830098-117830120 CCTCACTGCCTCCCTTGGCTGGG + Intergenic
996004726 5:118406106-118406128 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
996012953 5:118501711-118501733 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
996054494 5:118968546-118968568 ACTCACTGCCTCCCTTGGCTGGG - Intronic
996320081 5:122205603-122205625 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
996355999 5:122597471-122597493 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
996420750 5:123259185-123259207 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
996592206 5:125160612-125160634 CCTCACTGCTTCCCTTGGCTTGG - Intergenic
996638975 5:125730052-125730074 ACTCACTGCCTCCTTTGGCTGGG - Intergenic
996674050 5:126154739-126154761 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
997096856 5:130923492-130923514 ACTCACTGCCTCCCTTGGTTGGG - Intergenic
997326184 5:133023655-133023677 TGCCTCAGCCTCCTTTAGCTGGG - Intronic
997672767 5:135690044-135690066 ACCCACTGCCTCGGTTTGCTTGG + Intergenic
997744887 5:136290342-136290364 TCGAACTTCCTCCTTTAGCTCGG - Intronic
997874505 5:137536306-137536328 TCGAACTTCCTCCTTTAGCTCGG - Intronic
998009532 5:138683621-138683643 TCGAACTTCCTCCTTTAGCTTGG + Intronic
998359629 5:141573801-141573823 CCCCACCTCCTCCTTTGCCTGGG - Exonic
998788736 5:145743607-145743629 ACTCACTACCTCCCTTGGCTGGG - Intronic
999147513 5:149406087-149406109 TCCCTCTTTCTCCTTTTGCTTGG - Intergenic
999302968 5:150502429-150502451 TCCCACAGCCTTCTCTGTCTTGG - Intronic
999405088 5:151299922-151299944 CCTCACTGCCACCTTTGGTTTGG + Intronic
999570866 5:152918625-152918647 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1000084684 5:157879184-157879206 TCTCAGTGCCTCCTCTGCCTTGG + Intergenic
1000144765 5:158443740-158443762 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1000399839 5:160814183-160814205 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1000587785 5:163121775-163121797 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1000648045 5:163781809-163781831 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1000749444 5:165075297-165075319 ACTCACTGCCTCCCTGGGCTGGG + Intergenic
1001983462 5:176052937-176052959 TTGCACTTCCTCCTTTAGCTTGG - Intronic
1002234006 5:177791115-177791137 TTGCACTTCCTCCTTTAGCTTGG + Intronic
1002401986 5:178996059-178996081 TCCCACTCCCGCCTATTGCTTGG + Intronic
1002640507 5:180628508-180628530 TCCCTATGCCTCCTTTTGCGAGG - Intronic
1003069599 6:2935701-2935723 TCTCCCTGCCTCCTTGGCCTCGG + Intergenic
1003388418 6:5691130-5691152 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1003542129 6:7027076-7027098 TGTCACGGCTTCCTTTGGCTAGG - Intergenic
1003649676 6:7948120-7948142 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1003819827 6:9883499-9883521 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1004717151 6:18228619-18228641 TATCACAGCTTCCTTTGGCTAGG - Intronic
1004910556 6:20278725-20278747 TCCGATTGCCTCCTTTGGAAAGG + Intergenic
1005202580 6:23363914-23363936 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1005747252 6:28849643-28849665 TCAAACCGCCTCCTTTAGCTCGG - Intergenic
1005788812 6:29274631-29274653 TCAAACTTCCTCCTTTTGCTAGG - Intergenic
1005846227 6:29780950-29780972 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1005999606 6:30955105-30955127 TCCCTCTGCCTCCTTTCTCCAGG - Intergenic
1007824396 6:44589107-44589129 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1007860328 6:44901223-44901245 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1007977978 6:46120632-46120654 TCGTACTTCCTCCTTTAGCTCGG - Intergenic
1007988260 6:46229710-46229732 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1008151034 6:47951289-47951311 TCCCAATGCCCCTTTGGGCTAGG - Intronic
1008244325 6:49151167-49151189 ACTCACCGCCTCCTTTGGCTGGG + Intergenic
1008350002 6:50478707-50478729 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1008414655 6:51225528-51225550 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1008910496 6:56727128-56727150 TCTCATTGCCTCCTTTGGAAAGG + Intronic
1009056555 6:58342648-58342670 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
1009188449 6:60601015-60601037 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1009519002 6:64658295-64658317 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1009695423 6:67096590-67096612 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1009782182 6:68285065-68285087 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1010281610 6:74029614-74029636 TCTAACTTCCTCCTTTAGCTCGG + Intergenic
1010331206 6:74626243-74626265 ACTCATTGCCTCCCTTGGCTGGG - Intergenic
1010352221 6:74888217-74888239 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1010461448 6:76118661-76118683 CATCACTGCTTCCTTTGGCTAGG + Intergenic
1010463696 6:76142668-76142690 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1010476808 6:76298479-76298501 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1010483290 6:76379666-76379688 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1010511715 6:76728830-76728852 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1010553486 6:77251752-77251774 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1010675407 6:78737220-78737242 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1010789937 6:80053315-80053337 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1010869148 6:81017004-81017026 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1010876798 6:81116994-81117016 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1010945538 6:81969839-81969861 ACGCACTGCCTCCCTTGGCTGGG - Intergenic
1010990134 6:82470705-82470727 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1010993022 6:82501378-82501400 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1011200522 6:84831369-84831391 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1011209138 6:84936141-84936163 TCTCACGGCTTCCCTTGGCTAGG - Intergenic
1011251707 6:85378384-85378406 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1011283362 6:85699704-85699726 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1011298307 6:85847358-85847380 ACTCACGGCTTCCTTTGGCTAGG + Intergenic
1011304100 6:85907954-85907976 TCAAACATCCTCCTTTGGCTCGG + Intergenic
1011308675 6:85957847-85957869 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1011408157 6:87038132-87038154 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1011408294 6:87039081-87039103 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
1011432481 6:87302228-87302250 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1011884600 6:92078501-92078523 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1011921051 6:92577555-92577577 TGCCTCTGCCTCTATTGGCTTGG - Intergenic
1011956784 6:93033205-93033227 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1012074995 6:94672303-94672325 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1012317277 6:97795821-97795843 TCAGACTTCCTCCTTTAGCTCGG - Intergenic
1012570993 6:100728758-100728780 TCCCACTCTCTCCTTTGCCAAGG + Intronic
1012701089 6:102458539-102458561 CCTCACTGCTTCCCTTGGCTTGG - Intergenic
1012749118 6:103135017-103135039 TCCCACTGCTTCATTCTGCTGGG - Intergenic
1012757305 6:103248322-103248344 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1012844824 6:104375793-104375815 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1012869411 6:104656380-104656402 TGCCTCTGCCTCTGTTGGCTTGG - Intergenic
1013256349 6:108390309-108390331 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1013378148 6:109539544-109539566 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1013578335 6:111507626-111507648 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
1013646360 6:112145544-112145566 TCACACTGCCTGCTCTGTCTCGG - Intronic
1013853408 6:114542180-114542202 TCTCAATGCCTCCTTGGCCTCGG - Intergenic
1014064631 6:117110695-117110717 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1014132909 6:117855000-117855022 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1014277340 6:119401165-119401187 TCAGACTTCCTCCTTTAGCTCGG - Intergenic
1014357801 6:120433759-120433781 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1014369359 6:120584814-120584836 ACTCACCGCCTACTTTGGCTGGG + Intergenic
1014379809 6:120726132-120726154 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1014484835 6:121985427-121985449 ATTCACTGCCTCCTTTGACTGGG + Intergenic
1014513078 6:122348854-122348876 TCCCACTTCCCACTTTGCCTAGG + Intergenic
1014842784 6:126240150-126240172 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1014881334 6:126727446-126727468 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1014960068 6:127672361-127672383 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1015094333 6:129396715-129396737 CCGCACTGCCTTCTTTGGCAAGG - Intronic
1015136933 6:129882878-129882900 ACCAACAGCCTCCCTTGGCTGGG + Intergenic
1015238224 6:130994844-130994866 TCCGATTGCCTCCTTTGGAGAGG + Intronic
1016018598 6:139211680-139211702 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1016625128 6:146157892-146157914 TCCCACTCCCCATTTTGGCTTGG - Intronic
1016653080 6:146485201-146485223 TGCCCTTGCCTACTTTGGCTTGG + Intergenic
1018114703 6:160572101-160572123 CCTCACGGCTTCCTTTGGCTAGG + Intronic
1018179924 6:161214069-161214091 TCTTACTGCCTCCTTTGGAGAGG + Intronic
1018578278 6:165283254-165283276 ACTCACTGCCTCCCTTGGCTGGG - Intronic
1018782971 6:167085880-167085902 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1019097894 6:169600514-169600536 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1020330244 7:7010744-7010766 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1020600745 7:10271400-10271422 TCTAACTTCCTCCTTTAGCTCGG - Intergenic
1020645563 7:10810845-10810867 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1020874339 7:13674245-13674267 CCTCACAGCTTCCTTTGGCTAGG + Intergenic
1020874551 7:13677113-13677135 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1021065828 7:16171070-16171092 TCTCAGTGCCTCCTTGGCCTTGG - Intronic
1021156480 7:17216388-17216410 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1021661725 7:22925382-22925404 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1021753361 7:23827537-23827559 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1022619211 7:31965158-31965180 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1022880072 7:34576983-34577005 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1022934014 7:35153000-35153022 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1023196264 7:37642509-37642531 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1023606817 7:41938803-41938825 TCCCTCTGGCTCCTCTGGGTTGG + Intergenic
1024099420 7:46015335-46015357 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1024101467 7:46036771-46036793 TCCCAGTGTCTCCTTTAGCAGGG - Intergenic
1024205968 7:47160851-47160873 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1024372953 7:48607268-48607290 TCTCACAGATTCCTTTGGCTAGG + Intronic
1024380105 7:48686128-48686150 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1024393914 7:48844775-48844797 TCTCACTGCTGCCTTTGGCTAGG - Intergenic
1024401329 7:48927642-48927664 TCTCACTGTTGCCTTTGGCTAGG + Intergenic
1024526338 7:50353161-50353183 TCTCCCTGCCTCCTGTGCCTGGG - Intronic
1024552537 7:50575775-50575797 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1025146628 7:56511352-56511374 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1025621461 7:63175223-63175245 CCTCACTGCTTCCCTTGGCTAGG + Intergenic
1025874610 7:65469430-65469452 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1025996012 7:66528090-66528112 ACCCACTGCCCCCTGAGGCTTGG - Intergenic
1026643026 7:72143175-72143197 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1027283508 7:76626668-76626690 TCCCAGATCATCCTTTGGCTCGG - Intronic
1027335588 7:77147351-77147373 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1027577207 7:79946029-79946051 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1027701763 7:81478681-81478703 ACTCACGGCTTCCTTTGGCTAGG - Intergenic
1027709195 7:81576399-81576421 TGCCACTGCCTACTTTGCTTTGG - Intergenic
1027864638 7:83630013-83630035 TCTCATGGCTTCCTTTGGCTAGG + Intronic
1027943967 7:84722576-84722598 ACGCACTGCCTCCTTTGGCTGGG - Intergenic
1028027607 7:85866485-85866507 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1028211400 7:88078547-88078569 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1028395408 7:90364076-90364098 TCCAACTTCCTCCTTTAGCTCGG + Intronic
1028459092 7:91071453-91071475 ACTCACTGCCTCCCTTGGCTGGG - Intronic
1028517899 7:91698511-91698533 ACTCACCGCCTTCTTTGGCTGGG - Intronic
1028522928 7:91752448-91752470 TCCCACTGCCTCCTTTGGCTGGG - Intronic
1028643732 7:93072753-93072775 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1028918953 7:96289458-96289480 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1029041381 7:97580023-97580045 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1029076084 7:97935793-97935815 TCTCAGTGCCTCCTCTGCCTGGG + Intergenic
1029241611 7:99167195-99167217 CCCCACTGTCTCCTCTGCCTGGG + Intergenic
1029247290 7:99211551-99211573 TCCAACTCCCTCCTTTGTCCTGG - Intergenic
1029310447 7:99659023-99659045 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1029325316 7:99802560-99802582 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1029540467 7:101179619-101179641 TCCCCCCACCCCCTTTGGCTGGG - Intronic
1029591688 7:101511276-101511298 TCTCCCTGCCTCCCTTGGCCTGG + Intronic
1029780203 7:102723741-102723763 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1029850061 7:103452793-103452815 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1029979572 7:104865275-104865297 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1030132077 7:106209906-106209928 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1030269038 7:107651274-107651296 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1030413725 7:109213679-109213701 ACTCACTGCCTCCCTTGGCTTGG + Intergenic
1030692260 7:112547535-112547557 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
1030997154 7:116372435-116372457 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1031285015 7:119855996-119856018 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1031344603 7:120650556-120650578 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1031467970 7:122136869-122136891 TCCCACCACCTTCTTTGTCTGGG + Intronic
1031548858 7:123084271-123084293 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1031804504 7:126292289-126292311 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1032074325 7:128829455-128829477 TCCCCCTGGCTGCTCTGGCTGGG + Intergenic
1032603722 7:133327103-133327125 CATCACTGCTTCCTTTGGCTAGG + Intronic
1032646982 7:133835497-133835519 TCTGACTGCCTCCTTTGGAAAGG - Intronic
1032771966 7:135067937-135067959 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1032966387 7:137103315-137103337 TCACAGTGCTTCCCTTGGCTAGG - Intergenic
1033106972 7:138536157-138536179 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1033484429 7:141774882-141774904 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1033564976 7:142569658-142569680 ACTCACTGCTTCCTTTGGCTGGG - Intergenic
1033596522 7:142863372-142863394 TCCCACTTCCCCCTTTCACTGGG - Intronic
1033879332 7:145862182-145862204 ACTCACTGCCTCCCTTGGCTCGG - Intergenic
1034371192 7:150598282-150598304 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1034379644 7:150679543-150679565 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1034583230 7:152065387-152065409 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1034703787 7:153121973-153121995 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1034875237 7:154719706-154719728 TTCCCCTGCCTCCCTTGGCCTGG + Intronic
1035493420 7:159299562-159299584 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1035533162 8:371509-371531 TCCAACTTCCTCCTTTAGCTCGG + Intergenic
1035599631 8:889972-889994 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
1035882129 8:3254812-3254834 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1035900591 8:3455253-3455275 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1035921228 8:3678237-3678259 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1036516139 8:9446249-9446271 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1036837584 8:12088625-12088647 TCTCAGTGCCTCCTTGGCCTCGG + Intergenic
1036859378 8:12334873-12334895 TCTCAGTGCCTCCTTGGCCTCGG + Intergenic
1037033281 8:14136391-14136413 TGTCACTGCTTCCCTTGGCTAGG - Intronic
1037183445 8:16033688-16033710 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1037561628 8:20080226-20080248 TCCCACTGCCTCCTGTTACTAGG + Intergenic
1038211510 8:25522943-25522965 CCTCACTGCTTCCTTTGGCTAGG - Intergenic
1038366355 8:26939879-26939901 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1038655836 8:29450389-29450411 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1038846596 8:31236206-31236228 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1038870487 8:31488753-31488775 TCTAACTTCCTCCTTTAGCTTGG + Intergenic
1039284494 8:36026278-36026300 TCACACGGCTTCCCTTGGCTAGG - Intergenic
1039433004 8:37540313-37540335 TCTCTCTGTTTCCTTTGGCTGGG - Intergenic
1039639519 8:39204572-39204594 TCAAACTTCCTCCTTTAGCTTGG + Intronic
1039658159 8:39433185-39433207 ACTCGCTGCCTCCCTTGGCTGGG - Intergenic
1039686012 8:39802197-39802219 ACTCACTGCCTCCCTTGGCTGGG + Intronic
1040403513 8:47076697-47076719 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1040428889 8:47318144-47318166 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1040701711 8:50074721-50074743 TCTCAGTGCCTCCTTGGCCTAGG + Intronic
1040736294 8:50512857-50512879 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1040772205 8:50991424-50991446 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1040814555 8:51493481-51493503 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1040842983 8:51804262-51804284 TCCGATTGCCTCCTTTGGAGAGG - Intronic
1040863845 8:52028056-52028078 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1040959677 8:53018839-53018861 ACTCACTGCCTCCCTTGGCCGGG - Intergenic
1041120919 8:54585938-54585960 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1041286228 8:56265249-56265271 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1041287242 8:56273461-56273483 CCTCACAGCCTCCCTTGGCTGGG - Intergenic
1041294295 8:56338654-56338676 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
1041338161 8:56811518-56811540 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1041371527 8:57165776-57165798 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1041387578 8:57320297-57320319 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1041474435 8:58248538-58248560 CCTCACCGCCTCCCTTGGCTGGG - Intergenic
1041518340 8:58727182-58727204 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1041630278 8:60080005-60080027 TCCCACTTTCTCCTGTGGGTGGG + Intergenic
1041771677 8:61479525-61479547 TCTAACTTCCTCCTTTAGCTCGG + Intronic
1041779004 8:61557276-61557298 CCCCAAGGCCTCCCTTGGCTGGG + Intronic
1041944286 8:63424284-63424306 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1042489368 8:69380759-69380781 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1042614280 8:70631792-70631814 TGTCACGGCTTCCTTTGGCTAGG + Intronic
1042763165 8:72292230-72292252 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1042765990 8:72322205-72322227 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1042800660 8:72713860-72713882 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1042931275 8:74016103-74016125 TGTCACAGCTTCCTTTGGCTAGG - Intronic
1043177722 8:77043042-77043064 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1043233248 8:77829849-77829871 ACTTACTGCCTCTTTTGGCTGGG - Intergenic
1043236860 8:77879429-77879451 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1043305050 8:78783319-78783341 ACTCACTGCCTCCCTTGGCTGGG + Intronic
1043360524 8:79466573-79466595 TCTGACTGCCTCCTTTGGAGAGG + Intergenic
1043363267 8:79500096-79500118 ACTCACTGCCTCTCTTGGCTGGG + Intergenic
1043480828 8:80650366-80650388 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1043532364 8:81165579-81165601 CCTCACTGCTTCCCTTGGCTGGG - Intergenic
1043747763 8:83897992-83898014 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1043819062 8:84840168-84840190 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1044038679 8:87337685-87337707 ACTCATTGCCTCCCTTGGCTGGG + Intronic
1044117320 8:88350806-88350828 TCTCACTGCTTCCCTTGGCTAGG + Intergenic
1044178882 8:89164056-89164078 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1044195820 8:89375101-89375123 TCGAACTTCCTCCTTTTGCTTGG - Intergenic
1044225113 8:89709369-89709391 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1044278951 8:90334426-90334448 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1044508663 8:93049736-93049758 ACTCACAGCCTCCCTTGGCTGGG + Intergenic
1044546549 8:93466545-93466567 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1044601335 8:94008564-94008586 TCAAACTTCCTCCTTTAGCTAGG + Intergenic
1044811905 8:96071603-96071625 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1044880736 8:96719583-96719605 TCTCAGTGCCTCCTCTGCCTGGG - Intronic
1045177386 8:99740022-99740044 TCGTACTTCCTCCTTTAGCTTGG - Intronic
1045241207 8:100402996-100403018 TCAAACTTCCTCCTTTAGCTTGG - Intronic
1045293548 8:100853508-100853530 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1045705386 8:104916538-104916560 ACTCACTGCTTCCCTTGGCTGGG + Intronic
1045797674 8:106065171-106065193 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1045969165 8:108060234-108060256 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1046007582 8:108505238-108505260 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1046081465 8:109375442-109375464 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG + Intergenic
1048467016 8:134674183-134674205 TCTCACGGCTTCCCTTGGCTAGG - Intronic
1048842440 8:138577579-138577601 TCCCAGAGCCTCCTGTGGCCAGG - Intergenic
1049074511 8:140383363-140383385 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1049744224 8:144256399-144256421 TCCCCCTGCCCCCCTTGGCCAGG + Intronic
1050012023 9:1195065-1195087 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1050034743 9:1423686-1423708 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1050068226 9:1783411-1783433 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1050083086 9:1936006-1936028 TCAAACTTCCTCCTTTAGCTAGG + Intergenic
1050301553 9:4263925-4263947 CCTCACTCCCTCCTTTGGGTTGG + Intronic
1050330230 9:4538371-4538393 TCTCATTGCCTCCTTTGGAAAGG - Intronic
1050370795 9:4919987-4920009 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1050374042 9:4952651-4952673 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1050381280 9:5032946-5032968 TCAAACTTCCTCCTTTAGCTTGG - Intronic
1050393036 9:5167174-5167196 CCTCACTGCCTCCCTTGGCTGGG - Intronic
1050500929 9:6296544-6296566 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1050509083 9:6375381-6375403 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1050624246 9:7486667-7486689 TCCCAAGGCCTCCTTTGTTTTGG + Intergenic
1050630017 9:7549182-7549204 ACTCACCGCCTCCCTTGGCTGGG - Intergenic
1050660662 9:7879809-7879831 ACTCACTGCCTCCCTTGGCTGGG - Intronic
1050700222 9:8330101-8330123 TCTCACGGCTTCCCTTGGCTAGG + Intronic
1051142801 9:13995959-13995981 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1051296295 9:15600080-15600102 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1051308781 9:15746841-15746863 TCTCACAGCTTCCCTTGGCTAGG - Intronic
1051312545 9:15792023-15792045 TCCAACTTCCTCCTTTAGCTCGG - Intronic
1051314894 9:15818395-15818417 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1051320885 9:15903727-15903749 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1051327609 9:15989627-15989649 TCCAACTTCCTCCTTTAGCTCGG - Intronic
1051452672 9:17214994-17215016 TCGAACTTCCTCCTTTAGCTGGG + Intronic
1051790865 9:20800789-20800811 TCAGACTTCCTCCTTTAGCTCGG + Intronic
1051847911 9:21473641-21473663 TCCCACTTGCTCCCTTGACTGGG - Intergenic
1051905910 9:22094754-22094776 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1051913775 9:22184576-22184598 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1051913917 9:22185334-22185356 TGCCCCTGCCTCTGTTGGCTTGG - Intergenic
1051941202 9:22507806-22507828 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1051987359 9:23106280-23106302 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1052056736 9:23914911-23914933 TCTCAGTGCCTCCTCTGCCTGGG - Intergenic
1052117564 9:24667773-24667795 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1052131969 9:24858992-24859014 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1052149980 9:25103186-25103208 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1052199704 9:25763714-25763736 ACTCACTGCCTCCCTTGTCTGGG - Intergenic
1052369159 9:27645099-27645121 ACTCACTGCCTCCTATGGATAGG - Intergenic
1052441094 9:28497600-28497622 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1052451841 9:28640767-28640789 TCGAACTTCCTCCTTTAGCTTGG + Intronic
1052640386 9:31159889-31159911 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1052710845 9:32053644-32053666 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1052716883 9:32128472-32128494 CCTCACCGCCTCCCTTGGCTGGG - Intergenic
1052724789 9:32216772-32216794 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1052992808 9:34531484-34531506 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1053009683 9:34625903-34625925 TCCTACTGACTCCTTCAGCTAGG - Intronic
1053521002 9:38779619-38779641 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1053521140 9:38780568-38780590 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1053678659 9:40464531-40464553 ACTCACTGCCTCCCTTGACTGGG - Intergenic
1053928643 9:43092885-43092907 ACTCACTGCCTCCCTTGACTGGG - Intergenic
1054193159 9:62003612-62003634 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1054193301 9:62004561-62004583 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1054285065 9:63160411-63160433 ACTCACTGCCTCCCTTGACTGGG + Intergenic
1054291737 9:63300069-63300091 ACTCACTGCCTCCCTTGACTGGG - Intergenic
1054389754 9:64604612-64604634 ACTCACTGCCTCCCTTGACTGGG - Intergenic
1054505959 9:65911764-65911786 ACTCACTGCCTCCCTTGACTGGG + Intergenic
1054645106 9:67584130-67584152 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1054645248 9:67585079-67585101 TGTCACTGCTTCCCTTGGCTAGG + Intergenic
1054808819 9:69418709-69418731 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1054889472 9:70235197-70235219 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1055013922 9:71595756-71595778 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1055338578 9:75258636-75258658 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1055548674 9:77409499-77409521 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1055616293 9:78076152-78076174 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1055754638 9:79544752-79544774 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1055866223 9:80817044-80817066 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1055958194 9:81794056-81794078 CTCCACTGCCTCCTTTGTTTTGG + Intergenic
1056909731 9:90687458-90687480 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1057201330 9:93141971-93141993 ACCCTCTGCCTACTGTGGCTGGG + Intergenic
1057550674 9:96049330-96049352 TCCAGAAGCCTCCTTTGGCTCGG - Intergenic
1057711962 9:97453591-97453613 ACTCACTGCCTCCCTTGGCTGGG - Intronic
1057721074 9:97532321-97532343 TCCCAACCCCTCCTCTGGCTGGG + Intronic
1057738263 9:97687783-97687805 TCCCACTGCTGCCTTAGTCTAGG - Intronic
1058207996 9:102132002-102132024 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1058211321 9:102173632-102173654 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1058224076 9:102338405-102338427 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1058259748 9:102814273-102814295 TCTCACAGCTTCCCTTGGCTGGG - Intergenic
1058374230 9:104304841-104304863 ACTCACTGCCTCCCTTGACTGGG - Intergenic
1058517315 9:105790018-105790040 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1058595060 9:106606170-106606192 TCAAACTTCCTCCTTTGGCTCGG - Intergenic
1058750086 9:108031527-108031549 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1058988737 9:110234706-110234728 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1059004284 9:110384247-110384269 ACTCACCACCTCCTTTGGCTGGG + Intronic
1059596217 9:115723777-115723799 ACTCACTGCCTCCCTTGGCTTGG - Intergenic
1059673422 9:116513941-116513963 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1059675599 9:116536297-116536319 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1060387387 9:123244184-123244206 TCACACTGGCTTCTTTTGCTAGG - Intronic
1060405506 9:123371074-123371096 TCCTGCTGCCACCTTTGGCTTGG + Exonic
1061470847 9:130824309-130824331 TCCCTCTGCCTGCTTGAGCTGGG - Intronic
1061486720 9:130924024-130924046 TGCCACTCCCTGCTGTGGCTGGG + Intronic
1062043207 9:134413634-134413656 GCCCACTGGCTCCTCTGGCTTGG - Intronic
1062316003 9:135967253-135967275 TCCCCCTGCCTCGTTTGGTCTGG + Intergenic
1203758128 Un_GL000218v1:155329-155351 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1203465697 Un_GL000220v1:83891-83913 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1203717514 Un_KI270742v1:168003-168025 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1203533711 Un_KI270743v1:10230-10252 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1186003432 X:5040755-5040777 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1186593146 X:10952794-10952816 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1186702486 X:12106648-12106670 TGTCACTGCTTCCCTTGGCTAGG - Intergenic
1186743044 X:12538074-12538096 TGCCATAGCTTCCTTTGGCTAGG - Intronic
1186778597 X:12890946-12890968 GCCAAGTGCCTCCCTTGGCTTGG - Intergenic
1186931143 X:14392014-14392036 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1186993052 X:15089598-15089620 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1187436761 X:19278307-19278329 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1187453332 X:19418242-19418264 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1187605108 X:20874466-20874488 CCTCACTGCCTTCCTTGGCTGGG - Intergenic
1187620461 X:21047424-21047446 TCTCACTACTTCCCTTGGCTGGG - Intergenic
1187763237 X:22610359-22610381 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1187817399 X:23247537-23247559 TCCAATTGCCTCCTTTGGAGAGG + Intergenic
1187818110 X:23255708-23255730 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1187835436 X:23428236-23428258 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1187848392 X:23565609-23565631 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1187850311 X:23585248-23585270 TCCCACTGCATCCGTGGGATTGG - Intergenic
1188035959 X:25317871-25317893 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1188037811 X:25338260-25338282 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
1188084096 X:25882455-25882477 TCTCACGGCTTCCCTTGGCTAGG - Intergenic
1188219689 X:27526466-27526488 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1188238777 X:27759742-27759764 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1188525300 X:31082260-31082282 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1188669682 X:32868141-32868163 ACTCACTACCTCCCTTGGCTGGG - Intronic
1189092853 X:38105524-38105546 TCTAACTGCCTCCTTTGGAGAGG - Intronic
1189199925 X:39185303-39185325 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1189479121 X:41379745-41379767 TCCCAGTGCCCCCTCTGGGTTGG + Intergenic
1189619119 X:42816724-42816746 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
1189652401 X:43204097-43204119 AGTCACTGCCTCCCTTGGCTTGG + Intergenic
1189702642 X:43727719-43727741 TCTCACAGCTTCCCTTGGCTAGG + Intronic
1189824031 X:44898829-44898851 TCCCACAGCCTGCTTTTGCTGGG + Intronic
1189970587 X:46414831-46414853 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1190271624 X:48868647-48868669 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1190603110 X:52112311-52112333 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1190603912 X:52120342-52120364 TCCAACATCCTCCTTTAGCTTGG - Intergenic
1190720858 X:53146193-53146215 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1190808551 X:53862217-53862239 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1190942036 X:55051750-55051772 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1191028137 X:55937574-55937596 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1191065160 X:56340585-56340607 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1191079621 X:56495351-56495373 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
1191114762 X:56841132-56841154 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1191181144 X:57565147-57565169 TGTCACAGCTTCCTTTGGCTAGG - Intergenic
1191196573 X:57730316-57730338 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1191208827 X:57863404-57863426 TGCCACAGCTTCCCTTGGCTAGG - Intergenic
1191589806 X:62870158-62870180 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1191594020 X:62922834-62922856 CCTCACTGCCTCCCTTGGCTGGG - Intergenic
1191625431 X:63266017-63266039 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1191799115 X:65058024-65058046 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1191935451 X:66422942-66422964 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1191938804 X:66455024-66455046 TCAGACTTCCTCCTTTAGCTCGG - Intergenic
1192000900 X:67150385-67150407 TCAGAAAGCCTCCTTTGGCTGGG + Intergenic
1192004108 X:67191384-67191406 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1192049203 X:67708584-67708606 TCAAACTTCCTCCTTTAGCTTGG + Intronic
1192101159 X:68265728-68265750 TCAAACTTCCTCCTTTAGCTCGG - Intronic
1192136282 X:68603445-68603467 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1192243324 X:69351943-69351965 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1192335370 X:70215336-70215358 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1192352406 X:70368192-70368214 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1192364120 X:70456698-70456720 TCTTACTTCCTCCTTTGGTTTGG + Intronic
1192391155 X:70729359-70729381 TCGAACTTCCTCCTTTAGCTTGG - Intronic
1192666981 X:73098876-73098898 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1192712911 X:73610293-73610315 CCTCACTGCTTCCCTTGGCTGGG + Intronic
1192718804 X:73670134-73670156 ACTCACTGTTTCCTTTGGCTGGG + Intronic
1192798812 X:74446733-74446755 GCCCACTGCCATCTTTGGATAGG + Intronic
1192900390 X:75489791-75489813 TCGAACTTCCTCCTTTAGCTCGG - Intronic
1192922789 X:75724763-75724785 TCTCACGGCTTCCTTTGGCTAGG + Intergenic
1192931325 X:75809742-75809764 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1192980100 X:76330297-76330319 ACTCACTGCCTCCCTTGGTTGGG - Intergenic
1193051259 X:77102351-77102373 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1193059111 X:77185652-77185674 TCAAACTTCCTCCTTTAGCTGGG - Intergenic
1193066871 X:77269233-77269255 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1193093993 X:77527403-77527425 ACTCACTGCCTCCCCTGGCTGGG - Intronic
1193123321 X:77846374-77846396 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1193164414 X:78264551-78264573 GCTCACTGCCTCCCTTGGCTAGG + Intergenic
1193258679 X:79379922-79379944 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1193391829 X:80937755-80937777 TCAAACTTCCTCCTTTAGCTTGG - Intergenic
1193409298 X:81143586-81143608 TCTCACAGCTCCCTTTGGCTAGG - Intronic
1193461177 X:81792261-81792283 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1193505258 X:82334645-82334667 TCTCATTGCCTCCTTTGGAAAGG + Intergenic
1193533699 X:82686959-82686981 ACTCACTGCCACCCTTGGCTAGG + Intergenic
1193719913 X:84974757-84974779 TCTCAGTGCCTCCTTGGCCTCGG + Intergenic
1193840203 X:86400323-86400345 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1193895495 X:87110166-87110188 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1193909260 X:87281318-87281340 CCTCACTGCCTCCCTTGGCTTGG + Intergenic
1194021193 X:88694412-88694434 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1194058279 X:89164187-89164209 ACTCACTGCCTCCTTTGGCTGGG + Intergenic
1194177164 X:90665060-90665082 ACTCCCTGCCTCCTTTGGCTTGG - Intergenic
1194183044 X:90737254-90737276 ACTCATTGCCTCCCTTGGCTGGG - Intergenic
1194199066 X:90933219-90933241 TCCGATTGCCTCCTTTGGAAAGG + Intergenic
1194208568 X:91040401-91040423 TCTCACAGCTTCCCTTGGCTAGG + Intergenic
1194286708 X:92019986-92020008 ACTCACTGCCTCCCTTGGCTTGG - Intronic
1194391097 X:93319342-93319364 TCTCACAGCTTCCCTTGGCTAGG - Intergenic
1194445053 X:93976456-93976478 TCTCACCACCTCCCTTGGCTGGG + Intergenic
1194506477 X:94739454-94739476 ACTCACTGCTTCCCTTGGCTGGG + Intergenic
1194523070 X:94942526-94942548 GCTCACCGCCTCCCTTGGCTGGG - Intergenic
1194596631 X:95867505-95867527 ACTCACTGCCTCCTTTGGCTTGG - Intergenic
1194622957 X:96196143-96196165 ACTCATTGCTTCCTTTGGCTGGG - Intergenic
1194636437 X:96350305-96350327 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1194708058 X:97200118-97200140 CCTCACTGCTTCCCTTGGCTGGG - Intronic
1194813616 X:98416182-98416204 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1194879706 X:99235798-99235820 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1194906236 X:99578816-99578838 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1194944593 X:100051962-100051984 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1195088863 X:101439918-101439940 TCAAACTTCCTCCTTTAGCTCGG + Intronic
1195127500 X:101822738-101822760 CCTCACTGCTTCCCTTGGCTGGG + Intergenic
1195153345 X:102097063-102097085 ACTCACTGCCTCCTTTGGCTGGG - Intergenic
1195203861 X:102575488-102575510 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1195294138 X:103459488-103459510 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1195340475 X:103902058-103902080 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1195395666 X:104408175-104408197 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1195417433 X:104635784-104635806 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1195434755 X:104829356-104829378 ACCCACGGCTTCCCTTGGCTAGG + Intronic
1195587121 X:106578086-106578108 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1195723464 X:107890059-107890081 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1195812593 X:108851133-108851155 ACTCACTACCTCCCTTGGCTGGG - Intergenic
1195817570 X:108904838-108904860 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1195826884 X:109011570-109011592 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1195832174 X:109071566-109071588 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1195979436 X:110561624-110561646 TCTCACCGCCTCCCTTGGCGGGG + Intergenic
1195983048 X:110600705-110600727 ACTCACTGCCTCCCTTGGTTGGG - Intergenic
1196167884 X:112555406-112555428 ACTCACTGCCTCCCTTGGCTGGG - Intergenic
1196229365 X:113203159-113203181 ACTCACTGCCTTCCTTGGCTGGG + Intergenic
1196230220 X:113212437-113212459 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
1196236836 X:113291693-113291715 TTCCAATGCTTCCTGTGGCTGGG - Intergenic
1196252690 X:113480456-113480478 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1196381725 X:115098442-115098464 ACTCACTGCCTCCCTTGGTTGGG - Intergenic
1196478901 X:116122381-116122403 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1196517347 X:116628977-116628999 ACTCACCGCCTCCCTTGGCTGGG + Intergenic
1196874904 X:120148168-120148190 TTCCTCTGCTTCCTTTGGTTGGG - Intergenic
1196896882 X:120345436-120345458 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1196901649 X:120390014-120390036 TCGAACTGCCTCCTTTAGCTTGG + Intergenic
1197049640 X:122042871-122042893 ACTCACTGCCTCCCTTGGCTGGG + Intergenic
1197302861 X:124802513-124802535 ACCAACTGCCTCCCTTGGCTGGG + Intronic
1197432583 X:126384330-126384352 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1197489473 X:127100340-127100362 CCTCACTGACTCCCTTGGCTGGG - Intergenic
1197667812 X:129242038-129242060 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1197678146 X:129353002-129353024 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1197988142 X:132289416-132289438 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1198123740 X:133621397-133621419 TGTCACAGCTTCCTTTGGCTAGG - Intronic
1198165217 X:134049105-134049127 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1198172258 X:134118360-134118382 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1198216704 X:134562018-134562040 TCTTACTGCTTCCTTTGCCTAGG + Intergenic
1198489419 X:137123608-137123630 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1198615785 X:138457027-138457049 TCGGACTTCCTCCTTTAGCTCGG - Intergenic
1198706890 X:139459314-139459336 TCCCATTGCCTCCTTTTGTCAGG - Intergenic
1198712916 X:139524735-139524757 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1198753476 X:139958847-139958869 CCTCACTGCTTCCCTTGGCTGGG - Intronic
1198856121 X:141018703-141018725 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1198876011 X:141227408-141227430 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1198906570 X:141568664-141568686 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1199174744 X:144774002-144774024 TCTGACTGCCTCCTTTGGAGAGG + Intergenic
1199384388 X:147207028-147207050 TCTGACTGCCTCCTTTGGAAAGG - Intergenic
1199484136 X:148330402-148330424 TCAAACTTCCTCCTTTAGCTTGG + Intergenic
1199662961 X:150071049-150071071 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1199748748 X:150794407-150794429 TCCCACTGTTTCCTTTGGTCCGG - Intronic
1199767827 X:150953684-150953706 CCCCACTACCTGCTGTGGCTGGG + Intergenic
1199884703 X:152007955-152007977 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1199936914 X:152583084-152583106 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1200318703 X:155162360-155162382 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1200344468 X:155435162-155435184 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1200417338 Y:2926158-2926180 TCTGATTGCCTCCTTTGGATAGG + Intronic
1200523835 Y:4247205-4247227 ACTCACTGCCTCCTTTGGCTTGG - Intergenic
1200529663 Y:4319209-4319231 ACTCATTGCCTCCCTTGGCTGGG - Intergenic
1200604254 Y:5244546-5244568 ACTCACTGCCTCCCTTGGCTTGG - Intronic
1200642696 Y:5741619-5741641 TCCAACTGGCTCAATTGGCTGGG + Intronic
1200733935 Y:6773925-6773947 TCGAACTTCCTCCTTTAGCTTGG + Intergenic
1200751861 Y:6953619-6953641 TCGAACTTCCTCCTTTAGCTCGG + Intronic
1201245746 Y:12002388-12002410 TCAAACTTCCTCCTTTAGCTGGG + Intergenic
1201277611 Y:12313516-12313538 TTCCTCTGCTTCCTTTGGTTGGG - Intergenic
1201308365 Y:12570756-12570778 TCGAACTTCCTCCTTTAGCTTGG - Intergenic
1201375620 Y:13315788-13315810 TCTGACTGCCTCCTTTGGAGAGG + Intronic
1201599686 Y:15714181-15714203 TTGCACTTCCTCCTTTAGCTCGG - Intergenic
1201670649 Y:16516350-16516372 TGTCACGGCTTCCTTTGGCTAGG + Intergenic
1201755757 Y:17483960-17483982 TTCCTCTGCTTCCTTTGGTTGGG + Intergenic
1201800082 Y:17945364-17945386 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1201801471 Y:17960592-17960614 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1201845795 Y:18422025-18422047 TTCCTCTGCTTCCTTTGGTTGGG - Intergenic
1201913586 Y:19158267-19158289 TCTCACAGCTTCCATTGGCTAGG - Intergenic
1201934755 Y:19396448-19396470 TCCCACTGCCTCCTCTACCCAGG + Intergenic
1201942194 Y:19472475-19472497 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1201974939 Y:19839038-19839060 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1202081958 Y:21092781-21092803 ACTCACTGCTTCCCTTGGCTGGG - Intergenic
1202161149 Y:21938184-21938206 TCTCACTGCCTTCTTCCGCTGGG + Intergenic
1202230207 Y:22648189-22648211 TCTCACTGCCTTCTTCCGCTGGG - Intergenic
1202312949 Y:23547976-23547998 TCTCACTGCCTTCTTCCGCTGGG + Intergenic
1202361402 Y:24114529-24114551 TCGAACTTCCTCCTTTAGCTCGG + Intergenic
1202368391 Y:24182019-24182041 TTCTACCGCATCCTTTGGCTTGG - Intergenic
1202374661 Y:24223072-24223094 TCAAACTTCCTCCTTTAGCTCGG - Intergenic
1202496119 Y:25447048-25447070 TCAAACTTCCTCCTTTAGCTCGG + Intergenic
1202502394 Y:25488098-25488120 TTCTACCGCATCCTTTGGCTTGG + Intergenic
1202509376 Y:25555590-25555612 TCGAACTTCCTCCTTTAGCTCGG - Intergenic
1202557853 Y:26122618-26122640 TCTCACTGCCTTCTTCCGCTGGG - Intergenic