ID: 1028525373

View in Genome Browser
Species Human (GRCh38)
Location 7:91778989-91779011
Sequence GCAAATGTATGATGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028525368_1028525373 30 Left 1028525368 7:91778936-91778958 CCACCACTGTAGCTGTTTCAGGC 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG No data
1028525369_1028525373 27 Left 1028525369 7:91778939-91778961 CCACTGTAGCTGTTTCAGGCAAG 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028525373 Original CRISPR GCAAATGTATGATGAGAAAC AGG Intronic
No off target data available for this crispr