ID: 1028530704

View in Genome Browser
Species Human (GRCh38)
Location 7:91835443-91835465
Sequence AGAACACCTCCTCTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028530703_1028530704 -8 Left 1028530703 7:91835428-91835450 CCACAAGTAACTGAAAGAACACC 0: 1
1: 0
2: 1
3: 11
4: 241
Right 1028530704 7:91835443-91835465 AGAACACCTCCTCTGAAGTCTGG No data
1028530702_1028530704 -1 Left 1028530702 7:91835421-91835443 CCATAATCCACAAGTAACTGAAA 0: 1
1: 1
2: 16
3: 269
4: 4344
Right 1028530704 7:91835443-91835465 AGAACACCTCCTCTGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028530704 Original CRISPR AGAACACCTCCTCTGAAGTC TGG Intronic
No off target data available for this crispr