ID: 1028531718

View in Genome Browser
Species Human (GRCh38)
Location 7:91845673-91845695
Sequence TAGGATCCTGAATATGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028531711_1028531718 29 Left 1028531711 7:91845621-91845643 CCTAAGAGTGGAACTGGCAAGGA 0: 1
1: 0
2: 1
3: 11
4: 199
Right 1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG 0: 1
1: 0
2: 2
3: 3
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028531718 Original CRISPR TAGGATCCTGAATATGGGCA AGG Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
908042864 1:60133794-60133816 TCTGATCGTGAATATGGGGAGGG + Intergenic
908219920 1:61994847-61994869 AAGAATCCTGTATATGGGCTGGG - Intronic
913378452 1:118182829-118182851 TAGGAAGATGAATATGGGCTGGG - Intronic
914976720 1:152371299-152371321 TATGATGCTGAGTATGAGCAAGG - Intergenic
915225527 1:154408411-154408433 AAGGAGCCTGAAAATGGTCATGG + Intronic
915805671 1:158846665-158846687 TAGCATCTTGAATTTGGACATGG - Intronic
916360137 1:163958999-163959021 TGGGATTCTGCAGATGGGCAAGG + Intergenic
916568308 1:166002564-166002586 TATGATCCTGGACATAGGCATGG - Intergenic
916752394 1:167734895-167734917 AGGGATCCTGAATATTGGAATGG - Intronic
919130022 1:193439927-193439949 TAGGATCCTGTAAATTGGGATGG + Intergenic
920624558 1:207584420-207584442 TAGGATGCTTAATTTGGGAAAGG + Intronic
920748810 1:208654712-208654734 TAAGCTCCATAATATGGGCAGGG - Intergenic
920776433 1:208942634-208942656 TATGAGCCTGAATATGTCCATGG - Intergenic
921503584 1:215938394-215938416 TGGGCTCCTCAATATGGGCGGGG + Intronic
921550973 1:216535347-216535369 GATGTTCCTCAATATGGGCAGGG + Intronic
922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG + Intergenic
1067680349 10:48432261-48432283 TAGCATCTTGTATATGGGTAAGG + Intronic
1071733920 10:88276951-88276973 TAGGATCCAGAATTTATGCAAGG - Intronic
1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG + Intergenic
1077425173 11:2472722-2472744 AAGGAGCCTGACAATGGGCAGGG - Intronic
1077621993 11:3733888-3733910 TAGGTAGCTGAATATGTGCAAGG - Intronic
1077669104 11:4141602-4141624 TGGGATCCTGAAAATTGGAATGG + Intergenic
1078635559 11:13046545-13046567 TAGGATCCAGAATGTAGGGAGGG - Intergenic
1079607014 11:22382538-22382560 AATGATGCTGAATATGGGCAGGG - Intergenic
1079737831 11:24019350-24019372 TATGATCCCGAATATTGGCCAGG - Intergenic
1083928807 11:65827057-65827079 TGGGATCCTGAATGGGGGTAGGG - Intronic
1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG + Intergenic
1091857834 12:3753323-3753345 TGGGAGCCTGAATCGGGGCAAGG - Intronic
1092796795 12:12119267-12119289 AAGGATTCAGAATTTGGGCAAGG - Exonic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1098806865 12:75031990-75032012 TAGGATCCTGTAAATTGGGATGG + Intergenic
1101351578 12:103934607-103934629 GAGCATCCTGAATAAAGGCATGG + Intronic
1103670815 12:122613793-122613815 CAGGATTCTGAGTAGGGGCAGGG - Intronic
1104693940 12:130849121-130849143 GAGGGTCACGAATATGGGCAGGG - Intergenic
1105736855 13:23280612-23280634 TAGGATAAAGAATATGGGCTGGG + Intronic
1105926661 13:25014839-25014861 AAGGGCCCTGAATATGTGCAGGG + Intergenic
1107981928 13:45742297-45742319 TAGGAGCCTGAATTTTGACAAGG + Intergenic
1111123161 13:83880080-83880102 GAGGATCCTCAGTTTGGGCATGG + Exonic
1112173888 13:97001961-97001983 TGGGAGTCTGAATATGTGCATGG - Intergenic
1113371082 13:109726105-109726127 TAGGATTCTGAATGTGGGGCGGG + Intergenic
1113842803 13:113369952-113369974 GAGGGTCCTGAATAGGGGCTGGG - Intergenic
1115194291 14:30779228-30779250 TAGAAACCTGAAAATGGACAAGG - Intergenic
1116956690 14:50931169-50931191 TAGAATACTGAATATGGTCCTGG + Intronic
1117457483 14:55912490-55912512 TAGGAGCCCGGACATGGGCATGG + Intergenic
1118437140 14:65781968-65781990 TTAGATCCTGAAAATGGCCAGGG - Intergenic
1121363642 14:93286651-93286673 TAGGCTCAGGAATTTGGGCATGG - Intronic
1126978752 15:54217267-54217289 TAGGATTGTGGATAAGGGCAAGG + Intronic
1127577184 15:60303292-60303314 AAGGATGCTGAAGTTGGGCATGG - Intergenic
1130577864 15:85108237-85108259 TCGGATCCTGTACATGAGCAGGG + Intronic
1130815032 15:87422218-87422240 TAGTGTGCTGAAGATGGGCAAGG + Intergenic
1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG + Intronic
1135092654 16:19531670-19531692 TAAGATACTGAAGATGGGCCAGG + Intronic
1138722243 16:59096167-59096189 TAGGATGATGAATATTGACAAGG + Intergenic
1139951288 16:70672392-70672414 TAGGGTCCTGAATTGGGTCATGG + Intronic
1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG + Intergenic
1143811730 17:9477146-9477168 GAGGAACCTGAAGCTGGGCACGG - Intronic
1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG + Intergenic
1151314808 17:73315230-73315252 AAGGAGCCTGAATTTGGGTAAGG - Intergenic
1153048696 18:880975-880997 TGGGATCCTGGAAATGGGAATGG + Intergenic
1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG + Intergenic
1153835728 18:8962407-8962429 TAGGATCCTAAATATGGGACAGG - Intergenic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1157468603 18:47969910-47969932 TACAATCATGAACATGGGCATGG - Intergenic
1162269297 19:9600986-9601008 TTGGATCCTTAATATAGGTAGGG + Intergenic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1165337395 19:35181012-35181034 TGGGATCCTGAAAATTGGGATGG + Intergenic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
933175988 2:79173640-79173662 TTGGATCTTGACTATGGACATGG - Intergenic
937091514 2:119209462-119209484 TGGGATCCCGAATAAGGGAAAGG + Intergenic
941854695 2:170219165-170219187 AAGGAGCCTCAATGTGGGCAAGG - Intronic
941964277 2:171285207-171285229 TATGATCCTAAGTAAGGGCAGGG + Intergenic
943071294 2:183143489-183143511 TGGTGTTCTGAATATGGGCAGGG + Intronic
947346322 2:229193098-229193120 ATGGATCAGGAATATGGGCAGGG + Intronic
1171981408 20:31631872-31631894 TTGGCTCCTGCACATGGGCATGG - Intergenic
1172162419 20:32877962-32877984 TTGAATCCTGAGTATGGGAAGGG - Intronic
1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG + Intergenic
1177404935 21:20654343-20654365 AAGGATGCTGAACATTGGCAAGG - Intergenic
1178348346 21:31851257-31851279 GAGGATTCTGAATAAGAGCATGG - Intergenic
1182917172 22:34045035-34045057 TAGAATTCAGAAAATGGGCATGG - Intergenic
961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG + Intergenic
962494982 3:135930242-135930264 AATCATCCTGAATCTGGGCAGGG - Intergenic
963538574 3:146559217-146559239 TACCTTCCTGAATATGAGCATGG + Intergenic
964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG + Intergenic
968829490 4:2925453-2925475 TAGGATCCTGGATATAGAAAAGG - Intronic
971302948 4:25456806-25456828 TAAGACCCTGGATATGGCCATGG - Intergenic
971854220 4:32023278-32023300 TAGGTTCTTAAATATGGGAATGG - Intergenic
972095162 4:35339967-35339989 TAGGACCCTGAAACTTGGCAAGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
976071683 4:81247868-81247890 TATGATTGTGTATATGGGCAAGG - Intergenic
980771340 4:137377583-137377605 TAAGGTCCTGAATAAGTGCATGG - Intergenic
983859273 4:172685050-172685072 TAGAATGCTTAATATGTGCAAGG - Intronic
984842361 4:184080388-184080410 TAGGATCATGCCTATGGACAAGG + Intergenic
985422236 4:189795773-189795795 GAGGATGCTGGATGTGGGCAAGG - Intergenic
986181700 5:5399077-5399099 TATGAGGCTGCATATGGGCAGGG - Intergenic
986524977 5:8664087-8664109 TAGGATCCTGTATGTTGGAATGG + Intergenic
988936276 5:36086091-36086113 TACCCTCCTGAATATGGGAATGG + Intergenic
990898930 5:60729242-60729264 TGGGATGCTGAAGTTGGGCAGGG + Intergenic
990938181 5:61172994-61173016 TGGGATCCTGAACATGGGATGGG + Intergenic
995440336 5:112184721-112184743 TTGGATGCTGGATGTGGGCAGGG + Intronic
996953739 5:129158958-129158980 TACAATCCTGAACATGGGAATGG - Intergenic
998091717 5:139374920-139374942 TAGCATCCTCTAAATGGGCAGGG + Intronic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1007252585 6:40505977-40505999 CAGGATCCTGAATATTGAGATGG - Intronic
1007655601 6:43449405-43449427 CAGGATCTGGAATATGGGAATGG - Exonic
1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG + Intergenic
1016216449 6:141609161-141609183 TAGGATCCAGAAAATGGAAAAGG - Intergenic
1016895968 6:149053432-149053454 TATGACCCTGAACATGAGCATGG - Intronic
1017254052 6:152313382-152313404 TAGGGGCCTGAATAGGGGCTGGG - Intronic
1018550295 6:164989909-164989931 GAGGATACTGAAAATGGGCTGGG - Intergenic
1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG + Intergenic
1022864172 7:34400050-34400072 AGGGATCCAGAATTTGGGCAGGG + Intergenic
1024573171 7:50742424-50742446 TAGGATCCTGGTTAAGAGCATGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029306958 7:99626579-99626601 TAGGATCCTGGCTAAGGGCCTGG + Intronic
1030137220 7:106266279-106266301 AAGGATACTGTATGTGGGCAAGG - Intronic
1031636932 7:124112793-124112815 TAAGATCCTGAAGATAGGCTTGG - Intergenic
1032500081 7:132393451-132393473 TATGAACCTGGATTTGGGCATGG + Intronic
1033213989 7:139481032-139481054 AAGGCTCCTGAAGCTGGGCACGG - Intronic
1034734572 7:153416552-153416574 CTGGATCCTGAATATTGGAATGG - Intergenic
1037220500 8:16513557-16513579 TAGAAACATCAATATGGGCAAGG - Intronic
1038275430 8:26117115-26117137 GAGGATCAGGAATTTGGGCAAGG - Intergenic
1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG + Intronic
1042127956 8:65557981-65558003 TAGCATTCTGAGTATGGGCTAGG - Intergenic
1043449318 8:80350501-80350523 TAGGATCATTAATCTGGGCCAGG - Intergenic
1045279211 8:100735161-100735183 GAGCTTCCTGCATATGGGCAGGG - Intergenic
1046651805 8:116843781-116843803 GAGGATACTGCCTATGGGCATGG + Intronic
1048961426 8:139582704-139582726 TAGTATCCTGAGAATGGGGAGGG - Intergenic
1052163962 9:25299048-25299070 TTGGATGCTTACTATGGGCAAGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1055771614 9:79722697-79722719 TAGAATTCTGAAGAGGGGCATGG - Intronic
1058052259 9:100418826-100418848 AAGGAAACTGAATATGGACAAGG + Intergenic
1198526331 X:137504962-137504984 TAGGATCCTGGATCAGGGCCTGG - Intergenic