ID: 1028532275

View in Genome Browser
Species Human (GRCh38)
Location 7:91851368-91851390
Sequence CTGGACTCTCTGACAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028532275_1028532278 14 Left 1028532275 7:91851368-91851390 CCAGGATCTGTCAGAGAGTCCAG 0: 1
1: 0
2: 2
3: 12
4: 178
Right 1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG No data
1028532275_1028532277 3 Left 1028532275 7:91851368-91851390 CCAGGATCTGTCAGAGAGTCCAG 0: 1
1: 0
2: 2
3: 12
4: 178
Right 1028532277 7:91851394-91851416 ATGAAGCTGTAGTGCAGAAAAGG 0: 1
1: 0
2: 3
3: 21
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028532275 Original CRISPR CTGGACTCTCTGACAGATCC TGG (reversed) Intronic
900995605 1:6121722-6121744 CTGGCCTCTCTGACTTAGCCGGG - Intronic
901024043 1:6269806-6269828 CTGGACTCTGTCTCAGAGCCTGG - Intronic
901956213 1:12787618-12787640 CAGGGGTCTCTGACAGTTCCAGG + Intergenic
901979593 1:13023687-13023709 CAGGGGTCTCTGACAGTTCCAGG + Intronic
902002490 1:13205251-13205273 CAGGGGTCTCTGACAGTTCCAGG - Intergenic
902021724 1:13351015-13351037 CAGGGGTCTCTGACAGTTCCAGG - Intergenic
902887377 1:19415585-19415607 CTGGATCCTGTGACTGATCCTGG - Intronic
904336376 1:29800855-29800877 CTAGGCTCACTGCCAGATCCAGG - Intergenic
904614208 1:31741363-31741385 GTGCACTCACTGACAGATACAGG + Exonic
905465843 1:38152530-38152552 CAGAAATCTCTGACAGCTCCTGG - Intergenic
906861778 1:49368609-49368631 GTGGCTTCTCTGACAGCTCCAGG + Intronic
908041248 1:60116096-60116118 GTGGGCACACTGACAGATCCTGG - Intergenic
912149712 1:106843111-106843133 CTGGACACTCTGATAAATCCTGG - Intergenic
914841851 1:151254944-151254966 CTGGACTCCCTGAGTCATCCCGG + Intronic
916042461 1:160973094-160973116 CTGTTCTCTGTGACAGGTCCTGG + Intergenic
916586120 1:166152024-166152046 CTAGAGTCTCTGTCAGATACAGG + Intronic
918040214 1:180909391-180909413 CTGCAGTCTCTGACATATCTAGG + Intergenic
920437541 1:205957244-205957266 CTGCACTCTCTGCCAGCTCAGGG - Intergenic
921844213 1:219861682-219861704 CTGGGCTCTCTCACATATCTGGG - Intronic
922155049 1:223034516-223034538 CTGGCCTCTGTGGCAGATGCTGG + Intergenic
922790343 1:228307666-228307688 CAGGGCTCTCTGAGAGAACCTGG + Intronic
924563847 1:245179765-245179787 CTGGTCTTTCTGACACCTCCTGG - Intronic
1062860495 10:806005-806027 CTGGACTCTCGGAAGGATCTGGG + Intergenic
1065779708 10:29155923-29155945 CTGGATTGTCTGACAAGTCCAGG - Intergenic
1066096995 10:32081883-32081905 ATGGACTCTCAGACAGATCCTGG - Intergenic
1066588791 10:36969164-36969186 CTGGACTTTGTGACACAGCCTGG + Intergenic
1067328460 10:45292303-45292325 CTTCAGGCTCTGACAGATCCAGG - Intergenic
1067894287 10:50162523-50162545 CTGGACTATCTCTCAGCTCCAGG - Intergenic
1067954555 10:50777738-50777760 CTGGACTATCTCTCAGCTCCAGG + Intronic
1068266420 10:54656233-54656255 GTGGGTTCTCTGACAGGTCCTGG - Intronic
1068319312 10:55390601-55390623 CTGATCCCTCTGACAGATCTGGG - Intronic
1070336064 10:75456067-75456089 CTGGCCTCTCTGAAAGACTCTGG - Intronic
1071298499 10:84239762-84239784 CTGGGCTCTCTGAGAGGCCCAGG + Intronic
1071737421 10:88317780-88317802 CTGGGCACTCTGTCAGGTCCTGG - Intronic
1074068578 10:110042351-110042373 CTGGACTCTTTGTCACCTCCTGG - Intronic
1076309176 10:129491667-129491689 CTGAGCTCTCTGGCAGATCACGG + Intronic
1076424627 10:130358898-130358920 CTGGGCTTTCTGAGAGCTCCTGG + Intergenic
1078356458 11:10635537-10635559 CTGGAGCCTCTGGCAGAGCCAGG + Intronic
1078922844 11:15846243-15846265 CCGGTCTTTCTGACAGATCCAGG - Intergenic
1081531158 11:43960108-43960130 CTGGAATGTCTCACACATCCTGG - Intergenic
1086090833 11:83003128-83003150 CAGTGCTCTCTAACAGATCCAGG - Intronic
1086905206 11:92410772-92410794 CTGGCCTCCCTGCCAGAACCAGG + Intronic
1087158621 11:94927914-94927936 CTGGTCTCTCTGAAGGATCAGGG - Intergenic
1089614080 11:119685424-119685446 CTGGCCTGTCTGGAAGATCCTGG - Intronic
1089679187 11:120109981-120110003 CCGGACTCTCAGAAAGACCCTGG - Intergenic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1091202050 11:133788520-133788542 CTGGAGTCTCTTCCACATCCAGG + Intergenic
1092365164 12:7871591-7871613 CTGGAGTCTCTGACCCCTCCAGG + Intronic
1095764498 12:45879618-45879640 CTCAGTTCTCTGACAGATCCAGG + Intronic
1097155505 12:57009180-57009202 CTGGGTTCTGTGACAGATCCTGG - Intergenic
1101583798 12:106067124-106067146 CTGGAATCCCTGTCAGAGCCTGG - Exonic
1104227309 12:126848150-126848172 CTGGACCCTCTGAGAGATTCAGG - Intergenic
1104460969 12:128955624-128955646 CTGAACCCTCTGAAAGGTCCTGG + Intronic
1107993764 13:45841178-45841200 CTGGACTCCCTGTCACATCTTGG + Intronic
1111116011 13:83779247-83779269 GTGGGCTTTCTGACAGATCCTGG - Intergenic
1113529567 13:111012266-111012288 CTGGACTCTCTCAAAGGTCTAGG - Intergenic
1120693002 14:87614234-87614256 CTGGATTCTATGGGAGATCCAGG - Intergenic
1128256280 15:66199445-66199467 CTGGAGTCTCTGAAACATCAAGG - Intronic
1128914128 15:71544156-71544178 CTGGACTCCTTGACACACCCTGG - Intronic
1132853021 16:2033282-2033304 CTGAACTCTCTGGCCGACCCAGG - Intronic
1133485218 16:6213498-6213520 CTTGACACTCTAACAGACCCTGG + Intronic
1134445933 16:14331388-14331410 CAGGACTCTCAATCAGATCCAGG + Intergenic
1135672489 16:24387191-24387213 CTGGACTCTCGACAAGATCCCGG - Intergenic
1141112950 16:81285328-81285350 CTGGACTCTCTAATAGAGCTGGG + Intronic
1142644606 17:1303715-1303737 CTGAGCTTTCTGACAGCTCCAGG - Intergenic
1142735369 17:1895186-1895208 CTGTACTCACTGCCAGACCCCGG + Intronic
1142911224 17:3092933-3092955 CAGGACTCTCTGACATCCCCAGG + Exonic
1142930265 17:3278486-3278508 CTGGACTGTCTGACTCATGCGGG + Exonic
1142931869 17:3292151-3292173 CTGGACTGTCTGACTCATGCGGG + Exonic
1142945241 17:3420995-3421017 CTGGACTGTCTGACTCATGCGGG - Exonic
1146828595 17:36047062-36047084 ATGGGTTCTCTGACAGGTCCTGG - Intergenic
1147315581 17:39618580-39618602 ATGGTCTCTCTGGCTGATCCGGG + Intergenic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1147644988 17:42028076-42028098 CTGTGCTCTCTGTCAGCTCCAGG - Exonic
1148323437 17:46770739-46770761 CTGGACCCTGGGACAGAACCAGG - Intronic
1148451474 17:47780927-47780949 CTGGCCTCTTTGGCAGAACCTGG + Intergenic
1151322356 17:73359555-73359577 CTGGACTCGCTGGAAGCTCCTGG - Intronic
1152291293 17:79441544-79441566 CTGGCCTCTCTCCCAGATCTGGG - Intronic
1152401164 17:80067077-80067099 CTGGACCCTCAGAGAGAACCTGG - Intronic
1152864897 17:82716708-82716730 CTCGAGTCTCCGCCAGATCCGGG + Exonic
1153103235 18:1497825-1497847 ATGGACACTCTGACAGGTCCTGG + Intergenic
1153356392 18:4141562-4141584 CTGGACTCCCTGAAAAATCTTGG + Intronic
1153698586 18:7669057-7669079 CAGCACTCTCTAACAGACCCTGG - Intronic
1156739504 18:40306010-40306032 GTGGATTCTCCGACAGGTCCTGG + Intergenic
1157211448 18:45746022-45746044 CAGGAAACTCTGACAGAACCTGG + Intronic
1157726408 18:49967727-49967749 TTGGCCTCTCTGACAGACCCAGG - Intronic
1157777288 18:50405606-50405628 CTGTAGTCTCTCACAGTTCCTGG - Intergenic
1158153235 18:54395363-54395385 CTTGACTCTCAGACAGATCCCGG + Intergenic
1160316641 18:77854055-77854077 CTTGAATCTCTGGGAGATCCAGG - Intergenic
1161272674 19:3398641-3398663 CTGTACCCTGTGACAGCTCCGGG + Intronic
1163093915 19:15041763-15041785 CTGGACTCACTGTCACCTCCTGG + Intergenic
1164803589 19:31098650-31098672 CTGAACTCTTAGACAGCTCCAGG - Intergenic
1165956680 19:39505494-39505516 CTGGACTGTCTGAGCCATCCAGG - Intronic
1167312474 19:48745166-48745188 CTGGCTTCTCTGAGAGATTCGGG + Intronic
927240524 2:20916382-20916404 CTAGCCTCTCTGCCAGCTCCAGG + Intergenic
928206243 2:29285947-29285969 CAGGATTCTCTGACACAACCAGG + Intronic
929607442 2:43244412-43244434 CTGGAGGCTGTGACAGCTCCAGG - Intronic
929686743 2:44041557-44041579 TTGGACACTCTCACAGGTCCTGG + Intergenic
930668415 2:54122683-54122705 CAGGACTCTCAGAAAGATTCTGG + Intronic
931516039 2:63051262-63051284 CGGGTCTCTGTGAGAGATCCAGG + Exonic
933573847 2:84044625-84044647 TTCAATTCTCTGACAGATCCAGG - Intergenic
934855535 2:97727114-97727136 CTGTCCTCTCTGACTGATCTTGG - Intronic
936058544 2:109279768-109279790 CTGACCTCGCTGACAGAGCCAGG + Intronic
936451161 2:112634980-112635002 ATGGACTCACTGACAGGGCCAGG + Intergenic
942599469 2:177626251-177626273 CTGCAGTCTCTGTCAGACCCTGG + Exonic
1169073114 20:2745782-2745804 CTGGACTCTCTGCATGACCCGGG - Intronic
1169844213 20:9972057-9972079 CTGTGCTCTTTGACATATCCAGG - Intergenic
1169998169 20:11582878-11582900 CTGGACTCACTGGCAGACACAGG - Intergenic
1170145292 20:13167009-13167031 ATGGACTCTCTAACAGAAACAGG - Exonic
1171046155 20:21810486-21810508 CTGGTCTCCCTGGCAGGTCCTGG + Intergenic
1172571811 20:35976387-35976409 CTGAATTCTCTGAGAGATGCTGG + Intronic
1172599793 20:36175817-36175839 CTGGACACTGTGACTGGTCCAGG - Intronic
1179828870 21:43983544-43983566 CTGGACTCTCAGAGACGTCCAGG - Exonic
1182450604 22:30418359-30418381 CCACACTCTCTGACACATCCAGG - Intronic
1182923772 22:34103800-34103822 CTTGGCTCTCTGAGAGATGCAGG + Intergenic
1183407029 22:37635254-37635276 CCAGACTCTCAGACAGATGCAGG - Intronic
949860845 3:8503317-8503339 CTGGACTCTGTGACAGGGTCTGG - Intronic
955928249 3:64029186-64029208 ATTCAATCTCTGACAGATCCCGG - Intergenic
957772047 3:84707248-84707270 GTGGGCTCTCTGACAGGTCCTGG - Intergenic
959063809 3:101637917-101637939 CTGTAGTCTCTAACAGTTCCTGG - Intergenic
959330185 3:104995990-104996012 ATGGGCTCTCTGACAGGTCCTGG - Intergenic
960531864 3:118774243-118774265 GTGGGCACTCTGACAGAGCCTGG - Intergenic
960547287 3:118930240-118930262 CAGGGCTCTCTGACACTTCCAGG + Exonic
963479945 3:145859791-145859813 CTGGACTGACTCACATATCCTGG - Intergenic
965374766 3:167909591-167909613 CTGGAATATCTGACAGTTCAGGG - Intergenic
965770322 3:172175107-172175129 CTGGACTGTCAGACAAATCCAGG - Intronic
975241303 4:72062822-72062844 CTGGCCTCTCTCACACATCTGGG - Intronic
977200511 4:94109306-94109328 ATGCACTCTCTGACAGGTCTAGG - Intergenic
978928046 4:114274187-114274209 CTGAATTCTCTGACAGCTCTAGG + Intergenic
985381946 4:189404374-189404396 CTGGTATCTCTGACATACCCTGG - Intergenic
985484811 5:142047-142069 CTGGAACTTCTGACAGGTCCCGG + Intronic
986339667 5:6778318-6778340 CTGGCCTCACTGACAGAGCATGG + Intergenic
989555424 5:42789281-42789303 GTGGGCTCTCTGACAGGTCCTGG + Intronic
992278473 5:75146953-75146975 CTTGACTATCTGATAAATCCAGG + Exonic
992476370 5:77105764-77105786 CAGGACTGTCTGAGAGTTCCAGG + Intergenic
996977076 5:129447834-129447856 GTGGACTATCTGACTGAGCCAGG + Intergenic
998849065 5:146337493-146337515 GAGGACGCCCTGACAGATCCGGG - Intronic
1000981784 5:167824226-167824248 CCTGACACTCTGACAGACCCCGG + Intronic
1004440005 6:15641344-15641366 TTGGGCACTCTGACAGGTCCTGG - Intronic
1005847247 6:29791870-29791892 CTGGTTTCTCAGACAGCTCCTGG + Intergenic
1005851608 6:29827502-29827524 CTGGTTTCTCAGACAGCTCCTGG + Intronic
1005858987 6:29887393-29887415 CTGGTTTCTCAGACAGCTCCTGG + Intergenic
1005875207 6:30006236-30006258 CTGGTTTCTCGGACAGCTCCTGG + Intergenic
1006065944 6:31462845-31462867 CTGGTTTCTCAGACAGCTCCGGG + Intergenic
1006640948 6:35489603-35489625 CTGGCCCCTCTGACAGGTCAGGG - Intronic
1007139292 6:39555116-39555138 CTGGACTGTCTTAGAGATCAGGG + Intronic
1007291701 6:40792181-40792203 CTGGAGTCTCTGAAAGAAACTGG - Intergenic
1015692505 6:135940528-135940550 CTGAACTCCCTGACAGTGCCTGG - Intronic
1017182125 6:151563907-151563929 GTGGGCACTCTGACAGGTCCTGG + Intronic
1018219960 6:161568087-161568109 CTGGAATCACTGCCACATCCTGG - Intronic
1019418505 7:937904-937926 CTGAGCTCTGTGCCAGATCCGGG - Intronic
1019998014 7:4737657-4737679 CTGGACCCTCAGCCAGATGCTGG + Intronic
1022616985 7:31941549-31941571 CTGTGTTCTTTGACAGATCCAGG + Intronic
1023342075 7:39231605-39231627 CGGGTCTCTATGACTGATCCTGG + Intronic
1023488238 7:40709844-40709866 CCGGAATTTCTGACAGATCTGGG + Intronic
1025060175 7:55798700-55798722 CTGGACCGTCAGCCAGATCCTGG + Intronic
1027651381 7:80872987-80873009 GTGGACCCCCTGAAAGATCCTGG + Intronic
1028532275 7:91851368-91851390 CTGGACTCTCTGACAGATCCTGG - Intronic
1030280291 7:107767481-107767503 CTGGACTTTCTGCCACATGCAGG + Intronic
1030835321 7:114276758-114276780 CTGACCTCTCTTACAGATCTTGG + Intronic
1031011465 7:116528223-116528245 TTGGCCTCTCTGACTCATCCCGG - Intronic
1031134961 7:117873847-117873869 CTGAATTCTCTGAAAGATCAGGG + Intronic
1035516302 8:234944-234966 CAGGAATATCTGACAAATCCTGG + Intronic
1038476206 8:27870150-27870172 CTGGATTCTTTGCCAGAACCGGG + Exonic
1039891439 8:41688340-41688362 CTAGACTCTCTGCAAGATCAGGG + Intronic
1040073419 8:43206394-43206416 CTCGGCTCTCTGACAGGCCCAGG + Intergenic
1040857105 8:51959849-51959871 CTAGACTCTGTGACAGGTGCTGG + Intergenic
1042473631 8:69219980-69220002 CCCTACCCTCTGACAGATCCAGG - Intergenic
1043410482 8:79988766-79988788 CTGTACACACTGACAGATACAGG + Intronic
1044149558 8:88758207-88758229 CTTGTCTCTGTTACAGATCCTGG - Intergenic
1044467948 8:92528473-92528495 CCGGACTCCCTGACAGGCCCTGG - Intergenic
1044870742 8:96617474-96617496 CTTGGCTCTATGTCAGATCCAGG + Intergenic
1046594655 8:116247325-116247347 GTGGAGTCTCTGACAAATCTTGG + Intergenic
1047851745 8:128864844-128864866 CTGGTTTCTCTGACCCATCCTGG - Intergenic
1049536976 8:143186986-143187008 CTGGACTCCCAGACAGATGACGG - Intergenic
1050790200 9:9459030-9459052 GTGGGCTCTCTGATAGGTCCTGG - Intronic
1052119835 9:24699138-24699160 CTTGACTCTGTGATTGATCCTGG + Intergenic
1058154767 9:101502779-101502801 CTGAAGACTCTGACAGAGCCAGG - Intronic
1059432246 9:114257284-114257306 CAGGACCCTCTGCCAGCTCCAGG - Intronic
1060606078 9:124915191-124915213 CTGGAGTCAATGACAGAGCCAGG - Intronic
1061066685 9:128282638-128282660 CTGGACCCTTTGTCAGTTCCTGG + Intronic
1061918051 9:133767466-133767488 CTGGGCTCTTTCCCAGATCCAGG - Intronic
1186550529 X:10500381-10500403 CTGTATTCTCTGAAAGATCTAGG - Intronic
1186914954 X:14208734-14208756 ATGGGCTCTCTCACAGGTCCTGG + Intergenic
1187380307 X:18795501-18795523 CTGGAGTCTCTGGCAGCTTCTGG + Intronic
1193318559 X:80093664-80093686 CTGGACTCTCAGAATGGTCCTGG + Intergenic
1194067229 X:89276687-89276709 CTGGGCTCTCAAAGAGATCCAGG - Intergenic
1197104007 X:122692047-122692069 CTCAACTCTCTTACAGATCCAGG - Intergenic
1198440438 X:136658076-136658098 CTGAAATGCCTGACAGATCCGGG - Intronic
1199417887 X:147607619-147607641 CTGGACTCAGAGCCAGATCCAGG - Intergenic
1199628309 X:149759938-149759960 CCGGACCCACTGGCAGATCCTGG + Intergenic
1200171362 X:154077988-154078010 CAGGACTTGCTGACAGATCAGGG + Intronic
1200721390 Y:6610901-6610923 CTGGGCTCTCAAAGAGATCCAGG - Intergenic