ID: 1028532276

View in Genome Browser
Species Human (GRCh38)
Location 7:91851387-91851409
Sequence TGCACTACAGCTTCATTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028532276_1028532278 -5 Left 1028532276 7:91851387-91851409 CCAGAGAATGAAGCTGTAGTGCA 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028532276 Original CRISPR TGCACTACAGCTTCATTCTC TGG (reversed) Intronic
900665265 1:3810939-3810961 TGCTCCAGGGCTTCATTCTCAGG + Intergenic
902409126 1:16202495-16202517 TGCCCTGCAGCTTCAGGCTCAGG + Exonic
902888356 1:19423354-19423376 TCCACATCTGCTTCATTCTCCGG - Intronic
904946718 1:34204431-34204453 TCCACTTCAGCTTCCTTCTTAGG - Intronic
906295681 1:44647666-44647688 GGCAATACAACTTCAATCTCTGG - Intronic
906857125 1:49320004-49320026 TTCACTACAGCCTCAACCTCTGG + Intronic
907355545 1:53870243-53870265 CTCACTACAGCCTCAATCTCTGG + Intronic
908753474 1:67446291-67446313 TGCACTACAGCTTCAAACTCTGG - Intergenic
908850580 1:68372008-68372030 TGCACTACTGCTGGATTCTATGG - Intergenic
909735844 1:78960825-78960847 AGCACTGCAGATTCATTGTCTGG - Intronic
909929592 1:81480765-81480787 TGCACTTCAGTTTCCTTATCTGG - Intronic
910265117 1:85330370-85330392 GGCCCAACAGCTGCATTCTCGGG - Intronic
911561642 1:99413540-99413562 TGCAATTCAGCTTCCTTTTCAGG - Intergenic
914416608 1:147489438-147489460 TGCACTACAGCTACCTTTTTGGG - Intergenic
914973142 1:152329824-152329846 TGCCCAACATTTTCATTCTCGGG + Intergenic
915812967 1:158935665-158935687 AGCACTACAGTTTCATGCTGGGG - Intronic
917916152 1:179704230-179704252 TGAACTTCAACTTCATTCTGTGG + Intergenic
918044648 1:180934514-180934536 TTCACTACAGCCTCGATCTCTGG - Intronic
919017705 1:192061673-192061695 TGCCATACAGGGTCATTCTCAGG - Intergenic
919454740 1:197807915-197807937 TGCTATACAGGGTCATTCTCAGG - Intergenic
920809140 1:209265566-209265588 TGCTCTACTGCCTCACTCTCAGG + Intergenic
920959315 1:210650500-210650522 TGAACTATAGGTGCATTCTCGGG + Intronic
922339752 1:224645803-224645825 TGCAGTACATTTTCTTTCTCTGG + Intronic
922892134 1:229070248-229070270 TGCACAGCAGCTTCAATCTCAGG + Intergenic
923862276 1:237903683-237903705 TGCACTGCATTTTCATGCTCCGG + Intergenic
924650528 1:245922748-245922770 AGTAATAAAGCTTCATTCTCAGG - Intronic
1065235931 10:23652303-23652325 TGCATGACAGTTTCATTGTCTGG + Intergenic
1066251820 10:33640678-33640700 CTCACTACAGCTTCAACCTCTGG - Intergenic
1067133405 10:43586609-43586631 TGCATTACAGCTACTTTTTCTGG + Intergenic
1067575013 10:47403594-47403616 TGAAAGACAGCTACATTCTCAGG - Intergenic
1067661976 10:48243039-48243061 TGCACTACCGCTTCTTGCTGGGG + Intronic
1068049221 10:51927908-51927930 TGAACTAGACCTTAATTCTCTGG + Intronic
1068154853 10:53185690-53185712 TGCACTACAGCCTCACTCAGGGG - Intergenic
1071910715 10:90229755-90229777 ATCACTACAGCTTGACTCTCAGG + Intergenic
1072222248 10:93336319-93336341 TTCACAGCAGCTTCATTATCAGG + Intronic
1072396077 10:95042981-95043003 TGCACTACAGCATCAGTGTAAGG + Exonic
1079407768 11:20160570-20160592 TCCACTCGAGCTTCATTCGCCGG + Exonic
1079894234 11:26098430-26098452 TGCCATACAGGGTCATTCTCAGG + Intergenic
1079952094 11:26818753-26818775 ATCACTACAGCTCCATTCTCAGG - Intergenic
1080938357 11:36885783-36885805 TGCCATACAGGGTCATTCTCAGG - Intergenic
1081162616 11:39768415-39768437 GTCAATAAAGCTTCATTCTCAGG - Intergenic
1082066770 11:47907194-47907216 TGCACTTCACCATCATTCTGGGG - Intergenic
1084868773 11:72081345-72081367 CTCACTGCAGCTTCAATCTCCGG - Intronic
1085132720 11:74055325-74055347 TCCACTTCAGCTTCTTTATCTGG - Intronic
1085182422 11:74546920-74546942 TGCCATACAGGGTCATTCTCAGG + Intronic
1085189111 11:74602409-74602431 TGAATTACAGCTTCCTTCTTTGG + Intronic
1085383647 11:76142846-76142868 TGCATAACAGCTTCACTCACAGG + Exonic
1087364620 11:97202724-97202746 TGCACTATAGCTACAGTCACAGG - Intergenic
1087516921 11:99175580-99175602 TGAACTCCTGCTTCATTATCTGG - Intronic
1088161745 11:106880097-106880119 TGCCATACAGGGTCATTCTCAGG - Intronic
1088919881 11:114253073-114253095 TGCACTATGGCTTCCTCCTCTGG + Intergenic
1090356570 11:126144508-126144530 CTCACTACAGCCTCAATCTCTGG + Intergenic
1090537414 11:127658912-127658934 CTCACTGCAGCTTCAATCTCCGG + Intergenic
1096936544 12:55286286-55286308 TTCACTACAGCCTCAAACTCCGG + Intergenic
1098706733 12:73701284-73701306 TTCACTACAGCCTCAAACTCTGG + Intergenic
1100429324 12:94516402-94516424 GGTCCTAGAGCTTCATTCTCAGG + Intergenic
1102618143 12:114172751-114172773 TGCCATACAGGGTCATTCTCAGG - Intergenic
1104188836 12:126458425-126458447 TGCACTGCTGCTCCATCCTCAGG + Intergenic
1106590437 13:31093808-31093830 TGCATTCCAGCTTCACTCCCAGG + Intergenic
1111643927 13:91006189-91006211 TGCACTAGAGATTCAGTTTCAGG + Intergenic
1112092693 13:96098769-96098791 TGCACTTCAGTTTCCTTCTCTGG + Intronic
1112367325 13:98766471-98766493 TGCATTACAGCTACTTTTTCTGG - Intergenic
1115181059 14:30626347-30626369 TGCAATACAGGGTCATTCTCAGG - Intronic
1117374727 14:55109986-55110008 TGCCATACAGTGTCATTCTCAGG - Intergenic
1117374960 14:55111580-55111602 TGCCATACAGGGTCATTCTCAGG - Intergenic
1118070622 14:62243337-62243359 TGGTCCACAGCTCCATTCTCTGG - Intergenic
1118200234 14:63664279-63664301 TGCCATACAGGGTCATTCTCAGG + Intergenic
1120047966 14:79829918-79829940 TGCTCTACAGCTTCAAATTCAGG + Intronic
1124027018 15:25976329-25976351 TTCACTGCAGCCTCAATCTCCGG + Intergenic
1126298964 15:47174129-47174151 TGCACCCCATCATCATTCTCAGG - Intergenic
1127147768 15:56042660-56042682 TGCTATACAGGGTCATTCTCAGG - Intergenic
1127312879 15:57767983-57768005 TGCTGTACAGGGTCATTCTCAGG + Intronic
1127369885 15:58329933-58329955 TGGCCTACAGCTGCCTTCTCAGG + Intronic
1127915419 15:63451087-63451109 TGCCATACAGTGTCATTCTCAGG + Intergenic
1130314193 15:82781342-82781364 TGCTCTCCAGCTTTATTCGCTGG + Intronic
1131334002 15:91530033-91530055 TTCACTAAAGCTTCATGCTTAGG - Intergenic
1131498331 15:92934961-92934983 TGCACTTCAGTTTCCTTCTCTGG + Intronic
1131680982 15:94722979-94723001 TGCTCTACTGATTCAGTCTCTGG - Intergenic
1132625718 16:890580-890602 TGCACTCCAGCCTCAGTGTCTGG + Intronic
1134778928 16:16877818-16877840 TATAATACAGCTTCATTCTTTGG - Intergenic
1135018580 16:18944958-18944980 CTCACTATAGCTTCAGTCTCTGG - Intergenic
1140184134 16:72751561-72751583 TGCATTACAACTTCATTGACGGG - Intergenic
1140625768 16:76792976-76792998 TGCCCTGCAGGGTCATTCTCAGG - Intergenic
1141357263 16:83359091-83359113 TGCACTTCAACTTGATTCACTGG - Intronic
1143957269 17:10680868-10680890 TTCACTTCAGCTTGATCCTCTGG + Exonic
1144038153 17:11385706-11385728 TGCCCTATGGCTCCATTCTCAGG - Intronic
1144776732 17:17788551-17788573 TACACTGCTCCTTCATTCTCAGG + Intronic
1144856914 17:18274340-18274362 TGCATTACACCGTCCTTCTCAGG + Exonic
1145201065 17:20945083-20945105 AGCACTACAGGGTCATTCACTGG - Intergenic
1146986062 17:37219357-37219379 AGCACTACAGTTTTATTGTCAGG - Intronic
1149948688 17:60960572-60960594 TGGACTGCGGCTTCATTTTCTGG + Intronic
1151441561 17:74132660-74132682 TGCCATACAGGGTCATTCTCAGG + Intergenic
1151671318 17:75573207-75573229 TGCGCTACAGCTGCATCCGCCGG + Exonic
1153687224 18:7558232-7558254 TGCATGTCAGTTTCATTCTCTGG - Intergenic
1153893735 18:9540953-9540975 TGCATTATGGCTTCAGTCTCAGG + Intergenic
1155322156 18:24630438-24630460 TGCACAATATCTTCATTTTCAGG + Intergenic
1155826211 18:30446683-30446705 TGCCATACAGGGTCATTCTCAGG - Intergenic
1159344456 18:67181773-67181795 TGCAGTTCAGCTTCTTTGTCTGG - Intergenic
1160224982 18:77005548-77005570 TGGACTAGAACTTCACTCTCTGG - Intronic
1161227945 19:3156004-3156026 TGCACCAGAGCTTCCTGCTCAGG - Intronic
1164286305 19:23820599-23820621 TGCATAACAGCTACCTTCTCTGG + Intronic
1164444729 19:28307562-28307584 TTCACTGCAGCTTCAGCCTCTGG - Intergenic
1166897485 19:46032932-46032954 GGCACCACAGGTTCATCCTCTGG - Intergenic
1168004418 19:53475041-53475063 TGCATTATAGCTACTTTCTCTGG + Intronic
925235596 2:2274612-2274634 TACACTATACCTTCTTTCTCAGG - Intronic
926578055 2:14604409-14604431 TGTAAAATAGCTTCATTCTCTGG - Intergenic
928545036 2:32321810-32321832 TGCCATACAGGGTCATTCTCAGG - Intergenic
929010203 2:37434636-37434658 ATCACTACAGCTTGACTCTCAGG - Intergenic
930721691 2:54644350-54644372 TTCACCACAGCTTCCGTCTCAGG - Exonic
934655533 2:96115251-96115273 TCCTCTTCAGCTTCATCCTCTGG + Exonic
934707695 2:96496261-96496283 TGAACTACATCTTCGTTCTCTGG - Intergenic
935658303 2:105443670-105443692 GTCACTACAGCTTCTTGCTCAGG + Intergenic
936818359 2:116487709-116487731 GGCACTACAGCCCCATTTTCAGG + Intergenic
939706177 2:145456732-145456754 TCCACCACATCTTCATCCTCTGG + Intergenic
939881369 2:147635303-147635325 TGCCATACAGGGTCATTCTCAGG - Intergenic
939970843 2:148658292-148658314 TGCACTTCAGCACCATACTCGGG + Intronic
941700342 2:168597494-168597516 TGCCTTACAGGGTCATTCTCAGG + Intronic
943759366 2:191591965-191591987 TGCCATACAGGGTCATTCTCAGG - Intergenic
945512032 2:210714492-210714514 TCCTATACAGGTTCATTCTCAGG + Intergenic
945806132 2:214491900-214491922 TGTACTCCAGCTTCACTTTCTGG + Intronic
946530028 2:220560671-220560693 TGCCATACAGGATCATTCTCTGG + Intergenic
946904269 2:224401336-224401358 TGCAGTACAGCGTCACCCTCAGG + Exonic
947591737 2:231389821-231389843 TGAACTCCAGCTTCTCTCTCTGG + Intergenic
1168793197 20:593964-593986 TTCACTACAGCCTCCATCTCTGG + Intergenic
1168906182 20:1405542-1405564 TGCCATACAGAGTCATTCTCAGG + Intergenic
1170142045 20:13134051-13134073 TGCCATACAGGGTCATTCTCAGG + Intronic
1170320314 20:15089815-15089837 GCCACTACAGCTTCCTTCTCTGG - Intronic
1170923123 20:20697771-20697793 TGTGCTTCTGCTTCATTCTCAGG - Intronic
1175199087 20:57265991-57266013 TGCACTCGAGCTTCATCCACCGG - Exonic
1179515265 21:41902062-41902084 TGGTCTACAGCTTGATTCCCTGG + Intronic
1183143105 22:35962770-35962792 TGGACCAGGGCTTCATTCTCTGG + Intronic
1183609038 22:38884798-38884820 TGCACTCCAGCCTCAGACTCTGG + Intergenic
1183682139 22:39338308-39338330 TTTACTACAGTTTCATTCTTAGG - Intergenic
1184505250 22:44896950-44896972 CTCACTGCAGCTTCAATCTCTGG + Intronic
949217853 3:1591920-1591942 TCCTATACAGCTTCATTCTGAGG - Intergenic
949279692 3:2331607-2331629 TGCCATACAGGGTCATTCTCAGG - Intronic
950777810 3:15365450-15365472 TGCTATACAGAGTCATTCTCAGG + Intergenic
953634774 3:44653330-44653352 TGCCATACAGGATCATTCTCAGG + Intronic
954826315 3:53376747-53376769 CGCATCACAGATTCATTCTCTGG + Intergenic
956185930 3:66562011-66562033 AGCATCACATCTTCATTCTCTGG + Intergenic
956343098 3:68248592-68248614 TGCCATACAGAGTCATTCTCAGG - Intronic
956426311 3:69139409-69139431 TGCCGTACAGGGTCATTCTCAGG - Intergenic
956543733 3:70375063-70375085 TGCACTACAGCTAAAAACTCTGG - Intergenic
957205389 3:77191826-77191848 TGCAATAAAGCTTCATTGTAAGG - Intronic
959859747 3:111203859-111203881 TGCCATACAGGGTCATTCTCAGG + Intronic
959997355 3:112693880-112693902 GTCACTACAGCTCCACTCTCAGG + Intergenic
960833441 3:121877853-121877875 TGCACTACAGCCTCGAACTCAGG + Intronic
962104883 3:132380081-132380103 TGCCATACAGGGTCATTCTCAGG + Intergenic
962117778 3:132530116-132530138 TCCACTACTGCTTCTTTCCCGGG + Intronic
963775161 3:149431637-149431659 TGAACTTCAGCTTGTTTCTCTGG - Intergenic
967476834 3:189931491-189931513 TGGATTATAGTTTCATTCTCTGG + Intergenic
967762599 3:193241986-193242008 TGCTCTATACCTTCAGTCTCCGG - Intronic
968409954 4:381833-381855 TGAACTACAGCTACTTTCTGTGG - Intronic
969520528 4:7675452-7675474 TCCACTCAAGCTTCATTGTCTGG - Intronic
969954618 4:10875808-10875830 TGAACTTCAGCTTCACCCTCTGG + Intergenic
972245493 4:37243029-37243051 TTCACTCCAGAGTCATTCTCGGG - Intergenic
976151857 4:82100261-82100283 TTCACTGCAGTTTCATTGTCTGG + Intergenic
976599679 4:86926693-86926715 TGCCATACAGGGTCATTCTCTGG + Intronic
977595010 4:98869001-98869023 TGCACTACAGCCTCAAATTCTGG - Intergenic
977929223 4:102733425-102733447 TTCACTACAGCCTCAACCTCCGG + Intronic
977962943 4:103106129-103106151 TGCACTACAACATCATTACCAGG + Exonic
978707165 4:111727648-111727670 TGCACTCCAGCCTAATTCTTAGG - Intergenic
978907329 4:114022293-114022315 TCCAAAACAGCTTCATTCTGAGG - Intergenic
979057842 4:116017645-116017667 TGCATTACAGCTACCTTCTTTGG - Intergenic
981863669 4:149387432-149387454 TACCCAATAGCTTCATTCTCTGG + Intergenic
985131804 4:186745939-186745961 TGCCATACAGGGTCATTCTCAGG + Intergenic
990141295 5:52707096-52707118 TGCCATACAGGGTCATTCTCAGG + Intergenic
993993334 5:94687285-94687307 TGCACTACAGCTTCAAATTCTGG - Intronic
997752480 5:136359999-136360021 TGCAATACAGCTTGATTCCACGG + Intronic
998062328 5:139128573-139128595 ATCACTACAGCCTCATCCTCTGG - Intronic
999066891 5:148696948-148696970 TGCATTAGAACTTCATTCCCAGG - Intergenic
1000762661 5:165245462-165245484 AGCACTACTGATCCATTCTCTGG + Intergenic
1002090857 5:176805234-176805256 TCCACCCCAGCTTCAATCTCAGG + Intergenic
1004208307 6:13613232-13613254 TGCCATACAGGGTCATTCTCAGG + Exonic
1004638365 6:17490144-17490166 TGCACTGCAGCTGCATTCCAGGG - Intronic
1005733604 6:28723000-28723022 TTCACTGCAGATTCAATCTCTGG + Intergenic
1005838033 6:29722910-29722932 GTCTCTACACCTTCATTCTCAGG + Intronic
1006654538 6:35579040-35579062 TGTACTACAGCCTCAAACTCTGG - Intronic
1009315586 6:62215312-62215334 TGCTCTGCACCTTCATGCTCTGG - Intronic
1010579257 6:77574056-77574078 TGCCATACAGGGTCATTCTCAGG - Intergenic
1015388674 6:132655451-132655473 TTCACTGCAGCCTCAATCTCTGG + Intergenic
1016553628 6:145310648-145310670 CACACTATATCTTCATTCTCTGG - Intergenic
1016816377 6:148306739-148306761 TGTTCTACAGCCTCTTTCTCAGG - Intronic
1017408624 6:154146643-154146665 TGCATTCTAGCTTCATTCTTGGG + Intronic
1018581725 6:165313751-165313773 TGCAATATAGCTTCATTTTTGGG + Intergenic
1018897708 6:168032282-168032304 TGGTTTACAGCTTCCTTCTCCGG + Intronic
1021089225 7:16462727-16462749 GGCACTGCAGCTGGATTCTCTGG + Exonic
1021611937 7:22466047-22466069 TGCCATACAGGCTCATTCTCAGG + Intronic
1022346080 7:29515945-29515967 TGCCACACAGCATCATTCTCAGG - Intergenic
1022821098 7:33961700-33961722 TGCGCTACAGCTGCCTTCTAAGG - Intronic
1024340019 7:48247854-48247876 TTCACTTCAGCTGCATTCTATGG + Intronic
1024473828 7:49790280-49790302 GGCAATACAGCTTTCTTCTCGGG - Intronic
1024866154 7:53906753-53906775 AGCACTTCAGCTTCTTTCTAGGG + Intergenic
1024971521 7:55075709-55075731 TGCACCACAGCTGCCTTCTCTGG + Intronic
1028532276 7:91851387-91851409 TGCACTACAGCTTCATTCTCTGG - Intronic
1031716893 7:125119819-125119841 TGGGCTAGAGCTTCATGCTCTGG + Intergenic
1034011002 7:147529715-147529737 TGCACTAAAGGTTTATTTTCTGG - Intronic
1035183621 7:157108779-157108801 TAGACCACAGCTTCATTCTCAGG + Intergenic
1036529542 8:9570760-9570782 TGCCATACAGGGTCATTCTCAGG + Intronic
1037103909 8:15081222-15081244 TGGACAAAAGCTTCATTTTCAGG - Intronic
1037499545 8:19471847-19471869 TCCAGGACAGCTTCATTCTGGGG - Intronic
1038155392 8:24984529-24984551 TGCACTGCAGCTACTTTCTGTGG + Intergenic
1038433510 8:27518741-27518763 TGCCCCACAGCTTCATGCGCTGG + Intronic
1038803471 8:30770048-30770070 CTCACTGCAGCTTCAATCTCTGG - Intergenic
1040597297 8:48851458-48851480 TGTATTACAGCATCATCCTCAGG + Intergenic
1041866533 8:62581412-62581434 TTACCTATAGCTTCATTCTCTGG - Intronic
1042361773 8:67891859-67891881 TGCCATACAGCGTTATTCTCAGG - Intergenic
1043936082 8:86143927-86143949 TCCACTATAGCTTCATCCACAGG + Intronic
1046416838 8:113927306-113927328 ACCACCACAGCTTCTTTCTCCGG - Intergenic
1047093120 8:121595118-121595140 TGCCATACAGCATCATTTTCAGG + Intergenic
1048537557 8:135311670-135311692 TGCCATACAGGGTCATTCTCAGG + Intergenic
1052355374 9:27499273-27499295 TGCATTCCAGCTTCATCCTCTGG - Intronic
1055477909 9:76681621-76681643 TGCACTACAGCTTGATGTCCTGG + Intronic
1058580716 9:106453599-106453621 TACCCCACAGCTTCATTCCCTGG + Intergenic
1186690356 X:11968770-11968792 TGCCATACAGGGTCATTCTCAGG + Intergenic
1187253780 X:17622999-17623021 CTCACTGCAGCTTCATCCTCCGG + Intronic
1188672311 X:32894713-32894735 TGCAGTACAGGGTCATTCTAAGG + Intronic
1189919908 X:45893322-45893344 TTCACTAGGGCTTCATCCTCAGG - Intergenic
1196438410 X:115695132-115695154 TGCCATACAGGATCATTCTCAGG + Intergenic
1198638495 X:138727462-138727484 TTCACTTAAGATTCATTCTCAGG - Intronic
1199431881 X:147771023-147771045 TGCCATACAGAGTCATTCTCAGG + Intergenic
1199513031 X:148644036-148644058 TGCACTAAAACTCCATTTTCAGG - Intronic
1199599253 X:149532000-149532022 TGCACTGTACCTTCTTTCTCTGG + Intronic
1200087778 X:153617876-153617898 TGGAGTTCAGCTTCATTCTTTGG + Intergenic
1202355881 Y:24048343-24048365 TGCACTCCAGCCTCATTGACAGG - Intergenic
1202514897 Y:25621766-25621788 TGCACTCCAGCCTCATTGACAGG + Intergenic