ID: 1028532278

View in Genome Browser
Species Human (GRCh38)
Location 7:91851405-91851427
Sequence GTGCAGAAAAGGAAAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028532276_1028532278 -5 Left 1028532276 7:91851387-91851409 CCAGAGAATGAAGCTGTAGTGCA 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG No data
1028532275_1028532278 14 Left 1028532275 7:91851368-91851390 CCAGGATCTGTCAGAGAGTCCAG 0: 1
1: 0
2: 2
3: 12
4: 178
Right 1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028532278 Original CRISPR GTGCAGAAAAGGAAAGCAGC AGG Intronic
No off target data available for this crispr