ID: 1028534552

View in Genome Browser
Species Human (GRCh38)
Location 7:91878021-91878043
Sequence ATGGATAGGCATCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028534552 Original CRISPR ATGGATAGGCATCAGGAGGA TGG (reversed) Intronic
901468713 1:9440822-9440844 GTGGATGGGCATCAGCAGGGCGG - Intergenic
901676504 1:10888821-10888843 ATCGATACGCATCAGGCGGCGGG - Intergenic
901732013 1:11286848-11286870 TTGGATAGGAATCAGTAGGGTGG + Exonic
902543772 1:17173326-17173348 AGGGCTGGACATCAGGAGGATGG - Intergenic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
906661242 1:47584016-47584038 AAGGACAGTCATCAGGAGGCAGG - Intergenic
911512550 1:98825673-98825695 ATGGAAATGCATCATGAGTAAGG + Intergenic
912735289 1:112144949-112144971 AAAAATAGGCATCAGGAGGCTGG + Intergenic
913587295 1:120288116-120288138 AGGGAAAGGAATCAAGAGGAAGG + Intergenic
913620890 1:120610253-120610275 AGGGAAAGGAATCAAGAGGAAGG - Intergenic
914569311 1:148899999-148900021 AGGGAAAGGAATCAAGAGGAAGG + Intronic
914603516 1:149230257-149230279 AGGGAAAGGAATCAAGAGGAAGG - Intergenic
918761773 1:188419588-188419610 ATGAAAAGCCATCACGAGGATGG + Intergenic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923901473 1:238330414-238330436 ACGGATAGGGCTCAAGAGGAAGG - Intergenic
923980899 1:239322255-239322277 ATGCAAAAGCTTCAGGAGGATGG + Intergenic
924457730 1:244231591-244231613 ATGGATAGGGGTCGGGGGGAGGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1067314193 10:45145989-45146011 ATGGTTTGGAATCAGAAGGATGG + Intergenic
1068617566 10:59136656-59136678 ATGGATAGCCTTCAGAGGGAGGG - Intergenic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1070504839 10:77103993-77104015 ATGGAGAGGCAGCAGGACGCAGG + Intronic
1073313182 10:102558946-102558968 ATGGCAAGCCATCTGGAGGAGGG + Intronic
1074997490 10:118770426-118770448 ATGGCTGGCCAGCAGGAGGATGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG + Intronic
1077870498 11:6258610-6258632 ATGGATAGGAATCTGGAGATAGG + Intergenic
1078127696 11:8584635-8584657 AGGGCCAGGCATAAGGAGGAAGG - Intronic
1078670389 11:13359560-13359582 AGGGATAGGGATCAATAGGATGG + Intronic
1078734953 11:14011445-14011467 ATGGACAGGCCTCAGAAGGTTGG - Intronic
1084908004 11:72363605-72363627 ATGGATTGTCATGAGGATGAGGG - Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1086246616 11:84760906-84760928 ATGGATGGGGAGCAGGAAGAGGG - Intronic
1087472038 11:98587914-98587936 CTGGGGAGGCCTCAGGAGGAAGG + Intergenic
1088295004 11:108283415-108283437 ATGTTTAGGTATCAGGATGATGG + Intronic
1088456443 11:110037315-110037337 ATTGATAGGATTTAGGAGGAGGG - Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1091938664 12:4454562-4454584 TTGGAAAGGTCTCAGGAGGAAGG + Intergenic
1092517198 12:9226774-9226796 ATGGATAGTCATCAGAAGACGGG - Intergenic
1093888170 12:24487501-24487523 ATTGACAGGCATGAGGAGGCTGG + Intergenic
1094526685 12:31235724-31235746 ATGGAAAGACATCAGGAGGCAGG + Intergenic
1096425329 12:51496699-51496721 ATGGCTAGGGGTCAGCAGGAAGG - Intronic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1097212625 12:57383995-57384017 TTGGAAAGGCTTCAGAAGGAGGG + Intronic
1097543475 12:60969630-60969652 TTGGAAAGGCCTCAGAAGGAAGG - Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097914926 12:65011086-65011108 ATGGATAGGCATGAAGAAGGCGG - Intergenic
1098490470 12:71070241-71070263 ATGGAAAGCCATCAAGGGGAAGG + Intronic
1098954307 12:76672597-76672619 ATGAATGGACATCAGGAGGGAGG - Intergenic
1100151086 12:91738606-91738628 ATGGATAGACATCTGGTAGATGG + Intergenic
1100606300 12:96154613-96154635 ATGTGATGGCATCAGGAGGAGGG + Intergenic
1100717094 12:97317447-97317469 ATTGATAGGAATCACTAGGAGGG + Intergenic
1100796354 12:98185839-98185861 TTGGGTAGGCAGCAGAAGGAAGG - Intergenic
1101360613 12:104023131-104023153 ATTGCTATGCATCAGGGGGAGGG + Intronic
1102711545 12:114932492-114932514 ATGGTTAGGCTTCAGGTGCAAGG - Intergenic
1104634062 12:130426826-130426848 AAGGAAAGGCATCAGGGGGCGGG + Intronic
1106947666 13:34846874-34846896 CTGGGTAGGCCTCAGGAGGCTGG + Intergenic
1107197631 13:37672519-37672541 GTGGATAGGAATCATAAGGAGGG - Intronic
1108011932 13:46024315-46024337 AAGGATATACATCAGGAAGATGG - Intronic
1110944529 13:81396232-81396254 ATAGCTAGACATGAGGAGGAGGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113020498 13:105880316-105880338 ATGGTTACTCATCAGGGGGATGG - Intergenic
1113605546 13:111602663-111602685 GAGGAGAGGCATCTGGAGGAGGG - Intronic
1113843107 13:113371466-113371488 AGGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113843208 13:113371705-113371727 AGGGAGGGGCCTCAGGAGGAAGG - Intergenic
1113843238 13:113371783-113371805 ATGGAGGGGCCTCAGGAGGAGGG - Intergenic
1113843246 13:113371802-113371824 AGGGAGGGGCCTCAGGAGGATGG - Intergenic
1113843277 13:113371882-113371904 AGGGAGGGGCCTCAGGAGGAGGG - Intergenic
1114954433 14:27799631-27799653 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1118371888 14:65144436-65144458 GTGGAGAGGCATCGGGTGGAGGG + Intergenic
1119572956 14:75692633-75692655 ATGGATAGGTATGAGTAGAAAGG + Intronic
1119800212 14:77437709-77437731 ATGGATAGGCAGGAAGGGGAGGG - Intronic
1120689849 14:87580409-87580431 AAGGATGGACATCGGGAGGATGG + Intergenic
1121083067 14:91124330-91124352 AAGAGGAGGCATCAGGAGGAGGG - Intronic
1123978296 15:25573905-25573927 ATGGGTAGGAATCAGGGGGTAGG - Intergenic
1124129195 15:26970121-26970143 CTGGATAGGCATGAAGTGGAGGG - Intergenic
1124593248 15:31071557-31071579 ATGGAAGGCCATCAGAAGGAGGG - Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1128061149 15:64736766-64736788 CTGCAAAGGTATCAGGAGGAGGG - Intergenic
1128671379 15:69576896-69576918 AGGGATAGGAAGGAGGAGGAAGG + Intergenic
1128904110 15:71452119-71452141 GTGGTTAGGCATGAGGTGGATGG - Intronic
1129491142 15:75926742-75926764 AAGGATAGGCATGAGGTGAATGG + Intronic
1131387549 15:92019650-92019672 GTAGATAGGCTTCAAGAGGAGGG - Intronic
1131439900 15:92451852-92451874 ATGGATGGTGATCAGGAGCAGGG - Intronic
1131789155 15:95945705-95945727 ATGCTCAGGCATCAGGAAGAAGG + Intergenic
1133110651 16:3546096-3546118 ATGAATAGGAAGCAGGAGGTGGG + Intronic
1133383649 16:5351491-5351513 ATTGATGGGTCTCAGGAGGAGGG + Intergenic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1135470397 16:22724268-22724290 ATGGATAAACATCAGCAGGTAGG + Intergenic
1135548557 16:23381218-23381240 ATGGAAGGGCATCAGGTGTAGGG + Exonic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1138627139 16:58261374-58261396 AAGCATGGGCATCAGGAAGAGGG + Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1139305081 16:65978490-65978512 CTGGAAAGGCATCAGGAAAAGGG + Intergenic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1143373819 17:6455790-6455812 AGGGACAGGCATCAGGCGGAGGG + Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1144060427 17:11579216-11579238 ATTCATAGGCCTCAGGAGGAAGG - Intergenic
1146340690 17:32017355-32017377 ATGGTAAGGCATCAGGTGGGGGG - Intronic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1149383926 17:56123366-56123388 ATGGATAGGCTTGAAGATGATGG + Intronic
1150950435 17:69797927-69797949 ATGGATATGCATCAGGCAGCTGG + Intergenic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1154031235 18:10756019-10756041 AGGGATGGGGATAAGGAGGAGGG + Intronic
1161986567 19:7658181-7658203 AGGGTTAGGGTTCAGGAGGAAGG + Intergenic
1164592221 19:29513223-29513245 AGAGATAGGGATGAGGAGGAAGG + Intergenic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
926043532 2:9693250-9693272 CTGGACAGGCATCAGGAGGCTGG + Intergenic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
933352910 2:81178359-81178381 ATGGATGGGGACCAGGAAGAAGG + Intergenic
934482877 2:94669661-94669683 AGGTAGATGCATCAGGAGGAGGG - Intergenic
938961401 2:136344934-136344956 ATGGATAGGCATCTGAAGGAGGG + Intergenic
939684667 2:145184401-145184423 ATATATTGGCAGCAGGAGGAAGG + Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
944013315 2:195001010-195001032 ATGGCTAGGGTTCAGGAGGAGGG - Intergenic
945756383 2:213852452-213852474 ATGGATAGGGAGCGAGAGGAAGG - Intronic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
946266647 2:218549058-218549080 CTGGATAGGGATCAGAGGGAAGG + Intronic
947912798 2:233812376-233812398 ATGGATTGGCATCTCCAGGAAGG - Intronic
1169537698 20:6563369-6563391 AGAGATTGGCATCAGGAGGGAGG - Intergenic
1173190895 20:40875017-40875039 CTGGAATGGCATCAGGAGGGTGG - Intergenic
1173290755 20:41712912-41712934 ATGGACTGGCTACAGGAGGAGGG - Intergenic
1173817264 20:45997804-45997826 ATGAATAGGAAGCTGGAGGAGGG + Intergenic
1174682608 20:52423367-52423389 ATGGATAGGCATTCTGAGGCAGG + Intergenic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1175435499 20:58944659-58944681 ATGTATAGTCATCATGAGAAGGG + Intergenic
1180135466 21:45859395-45859417 ATGGCTATGCATCAGAAGCAGGG + Intronic
1180788495 22:18560142-18560164 AGGGATGGGCATCAAGTGGAAGG + Intergenic
1180835250 22:18926484-18926506 ATGGAGAGGCTTCTGCAGGAAGG - Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181233242 22:21435176-21435198 AGGGATGGGCATCAAGTGGAAGG - Intronic
1181245408 22:21499667-21499689 AGGGATGGGCATCAAGTGGAAGG + Intergenic
1185158100 22:49206249-49206271 ACGGATCAGCATCGGGAGGATGG - Intergenic
1185386986 22:50537933-50537955 ATGGCTGGGCTTCAGGAGCAAGG - Intergenic
1203285338 22_KI270734v1_random:151783-151805 ATGGAGAGGCTTCTGCAGGAAGG - Intergenic
949519585 3:4837584-4837606 ATGGATAGGAAGCAGGATGCGGG + Intronic
949719762 3:6975065-6975087 AAGGGTTGGCATCAGGAGCAAGG + Intronic
949824225 3:8148083-8148105 AAGGAAAGACCTCAGGAGGAAGG + Intergenic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
954696794 3:52431729-52431751 ATGGCTATTCATCAGGAGGCTGG + Intergenic
958597525 3:96246939-96246961 ATGGCTGGGTTTCAGGAGGAAGG + Intergenic
959254648 3:103992908-103992930 ATGGATAGGGAGCTGGAGGTGGG + Intergenic
960284460 3:115811268-115811290 ATGGATAGGAAGCTGGAGAAGGG + Intronic
960494844 3:118361524-118361546 ATGGATAGGAATGAGGAAAAAGG + Intergenic
962772586 3:138626973-138626995 ATGAACAGGCATCATGAGAAAGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
964281584 3:155072241-155072263 ATTGATGGGAATGAGGAGGATGG - Intronic
964847567 3:161060320-161060342 ATGTATGGGCAACAGGAGGGAGG + Intronic
967217074 3:187219950-187219972 ATGGATAGGCCGAAGGAGGGGGG + Intronic
968181092 3:196596000-196596022 ATGGAAAGCCATCAGGAGCCTGG + Intergenic
970152129 4:13101126-13101148 ATGGATAGGGAACACCAGGAGGG - Intergenic
974509712 4:62822912-62822934 ATGGATCAGCATCACTAGGAAGG - Intergenic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
983880040 4:172922914-172922936 ATAGCTAGGCATGAGCAGGATGG + Intronic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986394573 5:7315759-7315781 CTAGATAGGCAACAGGAGAAGGG + Intergenic
987110773 5:14684511-14684533 ATGGAAAGGCATCCACAGGAGGG - Intronic
987867539 5:23564687-23564709 ATGGAAAGGCATGAGGGAGAAGG - Intergenic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989227465 5:39046745-39046767 AAGGATATGGAACAGGAGGAGGG - Intronic
989530979 5:42507966-42507988 ATGGATATGCTATAGGAGGAGGG + Intronic
992041046 5:72833067-72833089 ATAGAAAGCCATCAGGAAGAAGG - Intronic
994313620 5:98306315-98306337 ATGGTTATGCAACAGGGGGATGG + Intergenic
995073367 5:107950985-107951007 ATGGCTGGGCATCTGGACGATGG + Intronic
995484855 5:112629796-112629818 CTGGATAGGCATTATGTGGATGG - Intergenic
995784072 5:115809655-115809677 ATGGATAGTGATCAGGGGGAAGG - Intronic
1002376545 5:178793262-178793284 AGGGATAGGCAGCACCAGGAAGG - Intergenic
1002563926 5:180099691-180099713 CAGGATGGGTATCAGGAGGATGG - Intergenic
1002925325 6:1602399-1602421 AGGGATGGGCAGCAGGAGGTGGG - Intergenic
1003088058 6:3077262-3077284 ATGAAAAGGAAACAGGAGGATGG + Intronic
1005188640 6:23192329-23192351 ATGGACAGGACTCAGGAGAAAGG - Intergenic
1005240689 6:23821881-23821903 TTGGATAGAAATCATGAGGATGG + Intergenic
1005250158 6:23936376-23936398 ACTGATACACATCAGGAGGAAGG - Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1009893186 6:69714010-69714032 ATGTATTGGGATCAAGAGGAAGG - Intronic
1010141356 6:72618613-72618635 ATGGGTAGGCATGAAGAAGAAGG + Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1015159492 6:130136564-130136586 ATGAATGGGCAGCAGGAGCAGGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1016804234 6:148196886-148196908 AGGGATAGGCATCCAGATGAAGG + Intergenic
1017685163 6:156906131-156906153 AGGGAGTGGCATCATGAGGAGGG + Intronic
1019015938 6:168879178-168879200 GTGGATAAGCATCATGGGGACGG + Intergenic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1026253951 7:68694627-68694649 ATGGATTGGCTGCAGGAGGTTGG - Intergenic
1027824111 7:83088816-83088838 AAGGAGAGGCCTCAGGAGGGAGG - Intronic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1031372481 7:120984902-120984924 ATGGAAAGTCACCAGGTGGAAGG + Intergenic
1031592701 7:123612578-123612600 ATGGATGGGGATCAGCTGGAGGG + Intronic
1033523814 7:142189824-142189846 ATGGCTAGGGCTCAGGAGGTAGG - Intronic
1033879971 7:145869097-145869119 ATGGTTGGGCACTAGGAGGATGG + Intergenic
1034893510 7:154860278-154860300 ATGGAGAGACATCAGGAGCATGG + Intronic
1035884950 8:3281657-3281679 ATTGCTAGGAATTAGGAGGAAGG + Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038325495 8:26569723-26569745 ATGGGCTGGCATCAGGAGGGAGG + Intronic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1041126778 8:54649376-54649398 GTGGACAGACATCAGGAGCAAGG + Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1053216198 9:36272658-36272680 ATGGATTGGGAAGAGGAGGAAGG + Intronic
1053439566 9:38105157-38105179 GTGGATAGGAATCAGGAAAATGG - Intergenic
1053674953 9:40415060-40415082 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1053924745 9:43041419-43041441 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054288229 9:63253592-63253614 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054386055 9:64555127-64555149 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054509666 9:65961233-65961255 AGGTAGATGCATCAGGAGGAGGG - Intergenic
1054926602 9:70595700-70595722 AGGGATAGGGCTCAGGAGGTAGG - Intronic
1055352614 9:75404760-75404782 ATGGATAGGATTCAGTAGGTAGG + Intergenic
1055995057 9:82148322-82148344 GTGGATTGGCAGCAGGAAGAAGG - Intergenic
1056839497 9:89987007-89987029 ATGGATAGACCTGAGAAGGAAGG - Intergenic
1057115019 9:92512892-92512914 GTGTATAGGCCACAGGAGGAAGG + Intronic
1057876502 9:98759209-98759231 ATGGCTTGGGATTAGGAGGAGGG - Intronic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1062437087 9:136551137-136551159 GAGGAGAGACATCAGGAGGATGG + Intergenic
1186196045 X:7111131-7111153 ATGGCAAGGCAGCAGGAGAAAGG - Intronic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1188822346 X:34790620-34790642 AATGATAGGGATCATGAGGATGG + Intergenic
1188931279 X:36114308-36114330 ATGGATAGGAATAAGGATCATGG - Intronic
1189408083 X:40743825-40743847 AAGGTTAGGCAACAGGAGGAAGG - Intergenic
1189526065 X:41823279-41823301 TTCGATAGGCAGCAGGTGGAGGG - Intronic
1191669993 X:63740126-63740148 AAGGGGAGGCATCAGGAGCAGGG - Intronic
1192411007 X:70932029-70932051 AGGGAGAGGCATCAGCAGCAGGG + Intergenic
1192842577 X:74872391-74872413 AGGGATAGACAGCAGAAGGATGG + Intronic
1193992993 X:88331935-88331957 ATGGATAGGCATTATTTGGAGGG + Intergenic
1197300557 X:124774918-124774940 ATGGAGAGGGAGCAGGAGAAGGG - Intronic
1198479048 X:137023719-137023741 ATGGAGAGGGGTCAGCAGGAAGG - Intergenic