ID: 1028538273

View in Genome Browser
Species Human (GRCh38)
Location 7:91913791-91913813
Sequence GAGTCAGAGGGCCTCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028538269_1028538273 5 Left 1028538269 7:91913763-91913785 CCTCTAAGAGTGATGTGCCAGGA No data
Right 1028538273 7:91913791-91913813 GAGTCAGAGGGCCTCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028538273 Original CRISPR GAGTCAGAGGGCCTCCAAAA AGG Intergenic
No off target data available for this crispr