ID: 1028545970

View in Genome Browser
Species Human (GRCh38)
Location 7:92000146-92000168
Sequence TAGAATCCCAAATAAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028545964_1028545970 13 Left 1028545964 7:92000110-92000132 CCTGTGTCTGGGCGTAGCCCTAT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1028545970 7:92000146-92000168 TAGAATCCCAAATAAGAACTGGG 0: 1
1: 0
2: 0
3: 9
4: 190
1028545965_1028545970 -4 Left 1028545965 7:92000127-92000149 CCCTATCTCCATTCCAAAATAGA 0: 1
1: 0
2: 2
3: 16
4: 304
Right 1028545970 7:92000146-92000168 TAGAATCCCAAATAAGAACTGGG 0: 1
1: 0
2: 0
3: 9
4: 190
1028545966_1028545970 -5 Left 1028545966 7:92000128-92000150 CCTATCTCCATTCCAAAATAGAA 0: 1
1: 0
2: 0
3: 55
4: 818
Right 1028545970 7:92000146-92000168 TAGAATCCCAAATAAGAACTGGG 0: 1
1: 0
2: 0
3: 9
4: 190
1028545963_1028545970 19 Left 1028545963 7:92000104-92000126 CCTTGGCCTGTGTCTGGGCGTAG 0: 1
1: 0
2: 2
3: 20
4: 148
Right 1028545970 7:92000146-92000168 TAGAATCCCAAATAAGAACTGGG 0: 1
1: 0
2: 0
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028545970 Original CRISPR TAGAATCCCAAATAAGAACT GGG Intronic
900842722 1:5067741-5067763 CAGACTCCAACATAAGAACTTGG + Intergenic
901586765 1:10301781-10301803 TAGAATTCCAAATAGTAAGTGGG - Intronic
907794108 1:57697344-57697366 CAGAATCGAAAATAAAAACTGGG + Intronic
908657126 1:66400340-66400362 CAGAATAGTAAATAAGAACTTGG - Intergenic
910438352 1:87228035-87228057 TAGCTTCCCAAAGAAGAGCTGGG + Intergenic
911208941 1:95119504-95119526 TAGATTCCCAATTGAGAAATGGG + Intronic
913030205 1:114894209-114894231 TAGAATCCAAAAGAAAAACCTGG - Intronic
913062734 1:115222830-115222852 GACAAAGCCAAATAAGAACTTGG + Intergenic
917148759 1:171922419-171922441 TAAAATCCCCAAAAAGAAATGGG - Intronic
917885636 1:179381699-179381721 TAAAATGCCAAATAACAAATTGG - Intronic
918232099 1:182544809-182544831 TAGAAACCAAAAAAAGAGCTGGG - Intronic
918478368 1:184950661-184950683 TAGCATCACAAATAAGAAGCTGG + Intronic
918763052 1:188439469-188439491 TAGAGTCCCAATCAATAACTTGG - Intergenic
920267745 1:204737017-204737039 TAGAATCCCAGACATGAGCTTGG - Intergenic
1063255059 10:4318395-4318417 TTGAATCCAAAATCAGAATTAGG - Intergenic
1064013649 10:11756334-11756356 TAGATTTCCAATTAAGAACAAGG - Intronic
1065615440 10:27516660-27516682 AAGAATTCCAAATTAGAAGTTGG - Intronic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1066518141 10:36186801-36186823 TATAATTCCAAAGAAAAACTTGG - Intergenic
1068035001 10:51748268-51748290 TGGAATCAGAAATGAGAACTTGG - Intronic
1068089575 10:52416300-52416322 TAGATTCCCAAAGAACAACAAGG + Intergenic
1068566640 10:58583130-58583152 TAGAATCAACAATAACAACTCGG - Intronic
1072154308 10:92710153-92710175 TAGATACTCAAATAAGTACTTGG - Intergenic
1073837617 10:107463024-107463046 CAAAATTCCAATTAAGAACTTGG + Intergenic
1073882916 10:108004796-108004818 AATAATCCTAAATGAGAACTGGG + Intergenic
1074435680 10:113432282-113432304 AGGAAACTCAAATAAGAACTCGG - Intergenic
1079717975 11:23772047-23772069 TTGAATTCAAAATAAAAACTTGG - Intergenic
1080293667 11:30700599-30700621 TAGTATCCCAAGTAAGACCCTGG + Intergenic
1085235774 11:75014219-75014241 TAGAATCAGAAATGAGAACCTGG + Intronic
1085945757 11:81270483-81270505 TAGAATTCCAAACAAGTATTTGG + Intergenic
1087617029 11:100498343-100498365 AATAATCTCAAATAAGAAATGGG + Intergenic
1089899628 11:121967162-121967184 TAAAATCCCAGAAAAGATCTTGG + Intergenic
1091984631 12:4898999-4899021 GAGAGTCCCAAAGAAGAATTAGG - Intergenic
1093567223 12:20621970-20621992 TAGAAGCCCAATTAAGAACCTGG + Intronic
1096474269 12:51898506-51898528 AAGAATCCCAAATAAGTTCAGGG - Intergenic
1098896887 12:76073196-76073218 TAGAAGTACAAATAAGAATTTGG - Intronic
1099645679 12:85352371-85352393 TAGAATATCAATTAAGAACAAGG - Intergenic
1101369276 12:104110479-104110501 TAGAGTCACAAATAAAAACATGG - Intergenic
1111059266 13:82991037-82991059 TGGTATCCCAAATACAAACTTGG - Intergenic
1113704887 13:112423424-112423446 TCCAATACCAAAAAAGAACTAGG + Intronic
1115045471 14:28987467-28987489 TAAAAACCCAAATAAAAAATAGG + Intergenic
1116615140 14:47126457-47126479 TAGCATGCCAAACAAGAAATGGG + Intronic
1117031279 14:51673355-51673377 CAGAATCCCAAAGAGGAAGTAGG - Intronic
1117740000 14:58807513-58807535 TTGAATACCAACTAAGAGCTAGG + Intergenic
1120298338 14:82674164-82674186 TAAAATCCCAAATAAGTAAATGG + Intergenic
1127072264 15:55298413-55298435 GAAAATCCCTAATAAAAACTTGG - Intronic
1127191125 15:56531833-56531855 TGGAATCCCAACTGAAAACTAGG - Intergenic
1130206592 15:81881155-81881177 TAGAAGCCAACATAAGGACTTGG + Intergenic
1131022685 15:89112630-89112652 TAGAATCAGAAAAAAGAAATTGG + Intronic
1131354053 15:91728361-91728383 TAGAATACAAAATAATCACTGGG - Intergenic
1134626701 16:15727494-15727516 TAGAATCCAAAATATCAGCTGGG - Intronic
1137918304 16:52456768-52456790 TAGAATGCCAAATAAACACCAGG + Intronic
1144227628 17:13165890-13165912 AAGAACCCAAAATAAAAACTGGG - Intergenic
1144371631 17:14596952-14596974 GAAAATCTCAAATAAGAAGTGGG - Intergenic
1144907783 17:18650408-18650430 TAAAATCCCACAGCAGAACTCGG + Intronic
1147551043 17:41441790-41441812 CTGAACCTCAAATAAGAACTTGG + Intergenic
1149428658 17:56579048-56579070 CAGAATCCCAAATTAGCACCTGG - Intergenic
1153895265 18:9553205-9553227 TAGAATACCACATAGAAACTTGG + Intronic
1158212233 18:55064731-55064753 TAGAAACCCAGAGAGGAACTAGG - Intergenic
1162445464 19:10719766-10719788 TTGAATCCCAAGTAAGGAGTGGG + Intronic
1165428228 19:35757141-35757163 TAGAAACCCAAACAATGACTTGG + Intronic
1166282750 19:41805964-41805986 TAGAATCCCAACTTAGAAAGAGG - Intronic
1168111424 19:54193420-54193442 TAGACTCCCAGAGAAGAGCTGGG - Exonic
925562834 2:5216660-5216682 AAAAATACCAAATAAGCACTTGG - Intergenic
925579145 2:5392575-5392597 TAGAGTTGCAAATGAGAACTTGG + Intergenic
929019426 2:37536894-37536916 TAAAATCCCACAGAAGGACTCGG - Intergenic
929083365 2:38143828-38143850 CAGAATCCCAAAGAAGTAGTAGG - Intergenic
930402197 2:50904418-50904440 TATGTTCCCAAATATGAACTTGG - Intronic
930648527 2:53938960-53938982 TGTAATCCAAAATAAAAACTTGG + Intronic
932937702 2:76124926-76124948 TGGATTCCTAAATAAGAACAGGG + Intergenic
933058153 2:77699994-77700016 TAGAATGCCAGCTAAGAATTTGG - Intergenic
933395688 2:81728086-81728108 TAGAATTAAAAATAACAACTGGG + Intergenic
933791173 2:85885105-85885127 CAAAAACCCAAATAAGAAATGGG + Intronic
935896476 2:107743403-107743425 TACAATTCCAAATAAGATTTGGG - Intergenic
936941125 2:117885491-117885513 TAGAACCACAAATGAGAGCTGGG + Intergenic
937532247 2:122843514-122843536 TAGAGACCAAAAAAAGAACTTGG + Intergenic
938709191 2:133960782-133960804 TAAAATCCTATATAAGCACTGGG - Intergenic
940175450 2:150872778-150872800 TAGTATCTGAAATAAGAACGTGG + Intergenic
940868434 2:158839376-158839398 GAGAAGTCCAAATAAGAAGTTGG - Intronic
943263338 2:185694563-185694585 TAGAATCCCTAATTAAATCTTGG + Intergenic
943654412 2:190492282-190492304 AAGAATCCCAAAGAACACCTGGG + Intronic
945219883 2:207472751-207472773 TAGGATCCCAAATTCTAACTAGG + Intergenic
945696881 2:213117740-213117762 TTAAATCACAAATCAGAACTTGG - Intronic
1170101563 20:12705910-12705932 TAGAATTTCAAATAGGAAATTGG + Intergenic
1175081104 20:56420876-56420898 GGGTATCCCAAATAAGGACTGGG + Intronic
1183746271 22:39693879-39693901 CAGAAGCCCAAAGGAGAACTTGG + Intergenic
1184496225 22:44843343-44843365 TAGAATGCCAAATAGAAATTGGG + Intronic
949606926 3:5663294-5663316 TATAATTCCAAATAATAATTTGG - Intergenic
949706529 3:6824447-6824469 CAGAATCCCAAAGATGAGCTGGG + Intronic
952236061 3:31481375-31481397 TAAAATCCCAGTAAAGAACTTGG - Intergenic
956294198 3:67694238-67694260 TATATTCCCAAATAAGGAATTGG - Intergenic
957699280 3:83687919-83687941 TCCAAGCCCAAATCAGAACTAGG + Intergenic
958042080 3:88238732-88238754 TCAATTCCCAAATAAGAATTTGG - Intergenic
959987944 3:112598129-112598151 TAGAGTGCCAAATTAGAACAGGG - Intergenic
960878490 3:122320951-122320973 GTGTAACCCAAATAAGAACTAGG + Intergenic
962737983 3:138342725-138342747 TAGAATGACAAATTAGAACACGG - Intergenic
963864376 3:150344421-150344443 TAGATGCCCAAACAAGAAGTTGG - Intergenic
964036406 3:152204157-152204179 TTTACTCCCTAATAAGAACTAGG + Intergenic
964696907 3:159518907-159518929 TAGAGACCCAAATAAAAATTAGG + Intronic
966236530 3:177707513-177707535 CACAGTACCAAATAAGAACTGGG + Intergenic
968280530 3:197473670-197473692 TAGAATCCCAAATAAAGGCAAGG - Intergenic
970735309 4:19160079-19160101 TTGAATCACACAAAAGAACTTGG + Intergenic
973535006 4:51872248-51872270 TGGAAGCCCAGATATGAACTGGG + Intronic
974777613 4:66506805-66506827 TGGCATCCCAAATAGGATCTTGG + Intergenic
974995474 4:69152828-69152850 TAGAACACCAAATATGAACTTGG + Intronic
975405435 4:73982967-73982989 TAGAATCCCACATAGGAAAGGGG + Intergenic
976496691 4:85738348-85738370 TAAAAGCCCAAATGAAAACTAGG - Intronic
977818970 4:101449760-101449782 TCAAATCCCAAATAAGAAATTGG - Intronic
979670527 4:123356075-123356097 TAGAATACAGAAAAAGAACTAGG + Intergenic
980317667 4:131223692-131223714 TAGAATTCCACATTAGATCTTGG + Intergenic
980842477 4:138281282-138281304 TAGAATAACAATTAAGAAGTTGG - Intergenic
981201145 4:141980838-141980860 TTGAATTCTAAATAAGACCTAGG + Intergenic
985279618 4:188272231-188272253 TAGATTCCCTAATAATAACAGGG - Intergenic
988373139 5:30398778-30398800 TAAAATCTCATATAACAACTAGG - Intergenic
988644830 5:33083314-33083336 TAGAATCGCATATAAAAATTGGG + Intergenic
989196460 5:38721449-38721471 CAGAATCCAGAATATGAACTGGG + Intergenic
989474998 5:41864705-41864727 TAGAAGGCCAAATAAAACCTTGG - Intronic
989637799 5:43555937-43555959 TAAAATCCCACAGCAGAACTCGG - Exonic
992188903 5:74271090-74271112 ATTAATCCCAAATAAGACCTAGG + Intergenic
993483971 5:88459408-88459430 TATAATCCCTACTAAGATCTTGG - Intergenic
993616737 5:90122395-90122417 TAGAGTTCCAAATGAGAAGTGGG - Intergenic
994119434 5:96097286-96097308 TGAAATCCCAATTAAGAACTGGG - Intergenic
994328497 5:98478290-98478312 TAAAATCCAAATTAAGAAATTGG + Intergenic
995484630 5:112627801-112627823 TAGAAACCCAAATCAGAAAAGGG - Intergenic
996086698 5:119312157-119312179 TAGAATCCCAGATAATAATTTGG - Intronic
1000276713 5:159743308-159743330 TAGAATCAAAAATATGAAATAGG + Intergenic
1001000951 5:168006532-168006554 TATAATTCCAAATACTAACTGGG + Intronic
1001696970 5:173677739-173677761 TAGAATCAGAAATAAAATCTTGG + Intergenic
1003251406 6:4431935-4431957 TAGAATTCAACATAAGAACGGGG + Intergenic
1003291667 6:4784749-4784771 TACAATTCCAAATGAGATCTGGG - Intronic
1003958011 6:11183791-11183813 AAAAATGCTAAATAAGAACTGGG + Exonic
1004553540 6:16673336-16673358 CAGAATCCCAAATATTAATTTGG + Intronic
1008356822 6:50564792-50564814 TTGAATCCAAAATAATATCTAGG + Intergenic
1009766609 6:68085527-68085549 TGAAATCCCTAATAAAAACTTGG - Intergenic
1010573268 6:77504157-77504179 TAGAATACCACATAGAAACTAGG - Intergenic
1011846922 6:91576512-91576534 TAGAAACTCAATTAAGAATTAGG + Intergenic
1012121071 6:95367241-95367263 TAGAATCCCACATGAGATTTGGG + Intergenic
1013592526 6:111631446-111631468 TAGGATCCCAAATCCAAACTTGG + Intergenic
1013642580 6:112101141-112101163 TAGCAACCCAAATATGAACAAGG - Exonic
1014346764 6:120280147-120280169 TTGAATCCAAAATAAGAATGAGG - Intergenic
1014452274 6:121595169-121595191 AAGAATCTCAGATAAGAACCTGG - Intergenic
1014753453 6:125278053-125278075 TAGAATTACAAACAAGAACTTGG - Intronic
1014932450 6:127350090-127350112 TAGAAACCATAAAAAGAACTAGG + Intergenic
1017605435 6:156127955-156127977 TAGAATCCCACAACAGAGCTCGG - Intergenic
1018471996 6:164105773-164105795 TAGAGCCCCTGATAAGAACTCGG - Intergenic
1020394078 7:7693470-7693492 GAGAAACCCAAATAAAAATTTGG - Intronic
1021914461 7:25417769-25417791 TAGAAACCCTAGCAAGAACTTGG + Intergenic
1022056248 7:26737948-26737970 TAAAATCCCAAATTTGAGCTGGG + Intronic
1023541246 7:41268869-41268891 TGGAATCACAAATTTGAACTGGG - Intergenic
1026281751 7:68928408-68928430 TAGAATCCCAAAGGGAAACTAGG + Intergenic
1027850816 7:83449398-83449420 TAAAATCCAAAATAAAAATTAGG - Intronic
1027929590 7:84514831-84514853 TAGAATGACAAATGAAAACTAGG + Intergenic
1028199284 7:87941943-87941965 TAGAGTCCCTTAGAAGAACTTGG + Intronic
1028545970 7:92000146-92000168 TAGAATCCCAAATAAGAACTGGG + Intronic
1029097271 7:98097774-98097796 TGGTATCCAAAATAAGATCTTGG - Intergenic
1029317980 7:99731924-99731946 AAGAATCACAACTAAGAACAAGG + Intronic
1030688875 7:112512552-112512574 TAGACTTCCAAATAAGAATGAGG - Intergenic
1031851325 7:126867825-126867847 TTGAATCCCACTTAAGACCTTGG - Intronic
1033308048 7:140239269-140239291 TTGTATCCCAAAGAAGAACCTGG - Intergenic
1033380687 7:140815105-140815127 AATAGTCCCAAAAAAGAACTTGG - Intronic
1033760956 7:144436130-144436152 CAGAATTCAAAATTAGAACTTGG - Intergenic
1034530537 7:151693638-151693660 TAGAATTCAACATAAGGACTTGG - Intronic
1039572449 8:38598534-38598556 TAGAATCCAAAACAACAACAAGG - Intergenic
1039734003 8:40310259-40310281 AATAATCCCAAATCAGAACAAGG - Intergenic
1040125971 8:43738242-43738264 AATAATCCCAGATAAAAACTAGG + Intergenic
1040395848 8:46999536-46999558 TAAAAGCCCAAATGAAAACTAGG + Intergenic
1040396060 8:47001376-47001398 AAGAAGCCCAAATAAAACCTAGG + Intergenic
1041540119 8:58974759-58974781 TAGAATCCTAACTAACAAATCGG - Intronic
1041669229 8:60476275-60476297 TAGATTGCAAAATAAGAATTAGG - Intergenic
1041982353 8:63877003-63877025 TAAAATCCAACATAATAACTTGG + Intergenic
1042732213 8:71948566-71948588 CAAAATCTCAAATAAAAACTAGG + Intronic
1043236282 8:77871433-77871455 TAGCATCACAAATAATAACTTGG - Intergenic
1043531239 8:81152888-81152910 TAGAATCCCAACTAAGCAGGGGG + Intergenic
1045228692 8:100278198-100278220 TAGAATGCCAAATAAGCACATGG + Intronic
1046789963 8:118310728-118310750 TAGAATGCCAGCAAAGAACTTGG + Intronic
1048596177 8:135868779-135868801 TAGAATCCCAAATGGCAAGTGGG - Intergenic
1051415573 9:16836425-16836447 TAGAATCCCAAACAATAATATGG + Intronic
1052179919 9:25512928-25512950 AAGAAGCTCAAAAAAGAACTAGG - Intergenic
1053609861 9:39701294-39701316 TAATATCCCAAGTAAGAATTTGG - Intergenic
1053867932 9:42459551-42459573 TAATATCCCAAGTAAGAATTTGG - Intergenic
1054088392 9:60769856-60769878 TAATATCCCAAGTAAGAATTTGG + Intergenic
1054243662 9:62641101-62641123 TAATATCCCAAGTAAGAATTTGG + Intergenic
1054557786 9:66675646-66675668 TAATATCCCAAGTAAGAATTTGG + Intergenic
1055105547 9:72508585-72508607 TATAAGGGCAAATAAGAACTGGG + Intergenic
1058231660 9:102434036-102434058 TAGACTCCAATTTAAGAACTCGG - Intergenic
1058803245 9:108565457-108565479 TAAAATCCCAAATAGGGTCTAGG - Intergenic
1059988146 9:119839779-119839801 TAGAAACCCATATATGAATTTGG + Intergenic
1186422853 X:9440073-9440095 CAGAATCCCACAAAAGAACAGGG + Intergenic
1187191393 X:17038612-17038634 TAGAATTCCAAATAGGACTTAGG - Intronic
1187820959 X:23287598-23287620 TGGAATGCCAACCAAGAACTGGG - Intergenic
1191577461 X:62722252-62722274 TATATCCCCAAATAAAAACTGGG - Intergenic
1191851131 X:65587298-65587320 AAAAATGGCAAATAAGAACTTGG - Intergenic
1193367965 X:80657764-80657786 TTGAAACCTAAATAAGAAGTAGG + Intergenic
1193787701 X:85780197-85780219 TATAATCCCAAAGCAGAACTAGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197099377 X:122634790-122634812 AAGACTCCCAAACAAAAACTGGG - Intergenic
1201507095 Y:14714098-14714120 AAGAAGCCCAAATAAAACCTAGG - Intronic
1202255465 Y:22916057-22916079 CAGAATCCCATATATGGACTAGG - Intergenic
1202408456 Y:24549806-24549828 CAGAATCCCATATATGGACTAGG - Intergenic
1202462326 Y:25120274-25120296 CAGAATCCCATATATGGACTAGG + Intergenic