ID: 1028546919

View in Genome Browser
Species Human (GRCh38)
Location 7:92012251-92012273
Sequence CTACTTTCCTTGAAAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028546917_1028546919 24 Left 1028546917 7:92012204-92012226 CCAAATATCACAATTTAGTATAA 0: 1
1: 0
2: 10
3: 35
4: 536
Right 1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG 0: 1
1: 0
2: 4
3: 49
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028546919 Original CRISPR CTACTTTCCTTGAAAAAGAA AGG Intronic
901285798 1:8077734-8077756 ATTCATTCCTTGAAGAAGAAAGG + Intergenic
903666103 1:25008681-25008703 CAATTTCCCTTGAAAAACAATGG + Intergenic
903806709 1:26010843-26010865 CTAGCTTCCTTGGAAAGGAACGG + Intergenic
904863707 1:33560080-33560102 CTAGGTCCCTAGAAAAAGAAGGG - Intronic
906239345 1:44232636-44232658 CCACATTCCAGGAAAAAGAAAGG + Intronic
906551035 1:46666677-46666699 AAACTTCCTTTGAAAAAGAATGG - Intronic
907175477 1:52517809-52517831 CTACTTTTCATGAAAAAGGATGG + Intronic
907745551 1:57209554-57209576 CCTCTTACCTTGAAAAACAAAGG - Intronic
909033978 1:70576047-70576069 CTAGTTTTCTTGTAAAAGAAAGG + Intergenic
909034179 1:70578698-70578720 CTTCTTTCCTTGAATGAAAATGG + Intergenic
909286720 1:73829015-73829037 CCACTAGCATTGAAAAAGAATGG + Intergenic
909443169 1:75720341-75720363 CTGCTTACCTTGAAATAGATGGG + Intergenic
909540391 1:76785060-76785082 ATACTTTCCCTGAAAAAGTCTGG + Intergenic
910552342 1:88489884-88489906 CTGATGTCCTTGTAAAAGAAGGG + Intergenic
910817673 1:91309922-91309944 CTACTATCATTTAAAAAAAAAGG + Intronic
911809658 1:102259678-102259700 CTTTTTTGCTTGATAAAGAAAGG - Intergenic
913454920 1:119020857-119020879 CCACTTTCTTTGACTAAGAAAGG - Intergenic
913933309 1:125007956-125007978 CCACTTTCTTTGACTAAGAAAGG - Intergenic
914230062 1:145757574-145757596 CTACTTTTAATGGAAAAGAAAGG + Intronic
915874111 1:159594299-159594321 CTATTTTGTTTAAAAAAGAAAGG + Intergenic
916410536 1:164542841-164542863 ATAGTTTCTTTGAAAAAAAATGG + Intergenic
916676457 1:167067829-167067851 TTTCTTTCCTTTAAAAAAAATGG - Intronic
916870175 1:168905376-168905398 GTACTTGCCTTGAAAAATTATGG - Intergenic
917628222 1:176867247-176867269 TTATGTTCCCTGAAAAAGAACGG + Intronic
917634465 1:176921494-176921516 CTACTCACTTTGTAAAAGAAAGG + Intronic
919831624 1:201544866-201544888 CAACCTTCCTTGAAAAAACATGG - Intergenic
919906330 1:202081004-202081026 TGACTTGCCTTGAAAGAGAAAGG - Intergenic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
921786510 1:219237312-219237334 CGATGTTACTTGAAAAAGAAAGG - Intergenic
921916556 1:220618431-220618453 CTTCTTTCCTTGGAAAAGCTCGG - Exonic
923917706 1:238528114-238528136 ATACGTTCCTAGAAACAGAATGG - Intergenic
924073067 1:240303083-240303105 TTACTTTCCTGGAATAAGAAGGG - Intronic
924403609 1:243718091-243718113 CTACTCTACTTGAAAAGGAAAGG - Intronic
924503175 1:244655540-244655562 CTAAATTCCTTAAAGAAGAAAGG - Intronic
1063302148 10:4859747-4859769 TTCCTTTCTCTGAAAAAGAATGG + Intergenic
1063399592 10:5729675-5729697 TTACTTTTCTTTAAAAAGAATGG + Intronic
1063525481 10:6780621-6780643 CAACAGTCCTTGAAAGAGAAAGG - Intergenic
1064169504 10:13017863-13017885 CACCTTTCCTTGGAAAAGAATGG + Intronic
1064924526 10:20555627-20555649 TTCCTTTCCTAGTAAAAGAAAGG + Intergenic
1064950983 10:20849990-20850012 CTATTTTCATTGAAAAAAAAAGG + Intronic
1065190716 10:23205177-23205199 ATACTTGACTAGAAAAAGAAAGG - Intronic
1065441187 10:25755269-25755291 CTCCCTTCCATGAAGAAGAAGGG + Intergenic
1065555194 10:26908064-26908086 CTAATTTCATTGAAATAGGAAGG + Intergenic
1066037008 10:31501358-31501380 CAACTTTTCTTGAATTAGAAAGG - Intronic
1066577555 10:36843244-36843266 CTAATTTCATTGAAATAGGAAGG - Intergenic
1068423434 10:56824007-56824029 GTATTTTCCTTGAACAACAAAGG + Intergenic
1069198600 10:65585470-65585492 CTCTGTTCCTGGAAAAAGAAAGG - Intergenic
1071188947 10:83078370-83078392 CTACTTTTCATGAAAAAGGAAGG - Intergenic
1072391748 10:94994358-94994380 CTACTTTCCTTGATGAAGGTAGG + Intergenic
1073848180 10:107583575-107583597 GTAGTTTGCTTGAAAGAGAATGG + Intergenic
1074608311 10:114996192-114996214 GTTCTTCCCTTAAAAAAGAAAGG - Intergenic
1075405854 10:122195319-122195341 GTAGTTTTCTTGAAAATGAAGGG + Intronic
1075905140 10:126074771-126074793 CTACTTTCCTTTTAAAACAGAGG - Intronic
1076174754 10:128359553-128359575 GTAATTTTCTTAAAAAAGAAGGG + Intergenic
1076580941 10:131510470-131510492 CTACTTTCTTTGACTAGGAAAGG + Intergenic
1077931267 11:6735466-6735488 CTACCTTTCATGAAAAAGGAAGG - Intergenic
1078000252 11:7488724-7488746 CTACTTTCCCTGAAAAAATCTGG - Intronic
1078973127 11:16438452-16438474 TTTCTTTCCTAGAAAGAGAATGG + Intronic
1079575739 11:22001294-22001316 CCCCTTTCCTTGACAAGGAAAGG - Intergenic
1079779789 11:24587067-24587089 CTACTTTCCTTGCAGAAAATTGG + Intronic
1080197321 11:29627581-29627603 CTATTTTGATTGAATAAGAATGG - Intergenic
1080406367 11:31983379-31983401 CTTCCTTCCTTGAAGATGAATGG + Intronic
1080771705 11:35348062-35348084 GCACTTTCCATGAATAAGAAAGG - Intronic
1081170488 11:39863822-39863844 CTAGTGTCCTTATAAAAGAAGGG - Intergenic
1081534333 11:43986317-43986339 ATATTTTCCTTTAAAAAGAGTGG - Intergenic
1082196115 11:49308359-49308381 CTATTTTCCTTGTAAAAAGATGG - Intergenic
1085559785 11:77460747-77460769 CTTCTTTCATTGTAAAAGAAGGG + Intronic
1085984992 11:81775660-81775682 CCCCATTTCTTGAAAAAGAAAGG - Intergenic
1086506606 11:87511415-87511437 CTACTTTCCAACAAAAAGAGGGG - Intergenic
1086599415 11:88614281-88614303 ATATTATCCTTGTAAAAGAAGGG - Intronic
1086774929 11:90818886-90818908 ATACTTTCCTTTAAAATTAAAGG + Intergenic
1087378585 11:97375938-97375960 CTCCTTACCTGAAAAAAGAATGG + Intergenic
1087451620 11:98330679-98330701 CCACTTTCCTTGACTAGGAAAGG + Intergenic
1088200122 11:107323081-107323103 CTACTTCTTATGAAAAAGAAAGG + Intergenic
1089217571 11:116844050-116844072 CTCCTTTCCCAGAAAAAAAAAGG + Intronic
1089347636 11:117800899-117800921 ATACTTTTCTTCAAAAACAAAGG + Intronic
1089930715 11:122308498-122308520 TTAATGTCCTTGAAAACGAAAGG - Intergenic
1090104798 11:123841379-123841401 CTAATTTCCTTGTAACAGAAAGG + Intergenic
1092190639 12:6517485-6517507 CTACTTACCTTGCAGGAGAAAGG - Exonic
1093123596 12:15301797-15301819 CTATTTTCCTTAAAAAATATTGG + Intronic
1093289010 12:17299724-17299746 CTCCCTTCCTAGAAAAAGCAAGG - Intergenic
1094244776 12:28276263-28276285 TTATTTTTCTTTAAAAAGAAAGG + Intronic
1095629837 12:44362668-44362690 CTATTTTCAATGAAAAATAATGG + Intronic
1095638622 12:44460530-44460552 ATCCTTTTCTTTAAAAAGAAAGG - Intergenic
1095717042 12:45357668-45357690 ATATTTTGTTTGAAAAAGAAAGG + Intronic
1095732260 12:45518938-45518960 CTGCTTTCCTTGAAATACCATGG - Intergenic
1095753388 12:45735312-45735334 TTTCCTTCCTTGAATAAGAAGGG - Intronic
1095889638 12:47223512-47223534 TTTCTTGCTTTGAAAAAGAAAGG - Intronic
1097086471 12:56472052-56472074 GTACTTTTGGTGAAAAAGAAAGG + Exonic
1097163151 12:57064508-57064530 CTACTCTCCTTGATTCAGAAAGG - Intronic
1097732191 12:63141169-63141191 CTACTTTACTTGAAAATTAAAGG + Intergenic
1098389689 12:69956479-69956501 CTACTTTCCATGAAGATAAATGG + Intronic
1099581094 12:84447614-84447636 CTAGTTTCATTTGAAAAGAATGG - Intergenic
1100228485 12:92583186-92583208 CAACTTTTCTTTAAAAAAAAAGG + Intergenic
1100530388 12:95456540-95456562 CTGCAAACCTTGAAAAAGAAGGG - Intergenic
1100595346 12:96066817-96066839 CTACTTTGCCTGAAAAAAATGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101509647 12:105381133-105381155 CAACTTTCCCTGGAAGAGAAGGG - Intronic
1102879890 12:116476311-116476333 CCACTTTCTTAGAAACAGAATGG - Intergenic
1105664913 13:22543260-22543282 CTACTTCCTTTGCAAAAGCATGG + Intergenic
1107417032 13:40210344-40210366 CAACTAACCTTGAAAAAGGATGG + Intergenic
1108776338 13:53769464-53769486 TTACTTTACTTGGAAAAAAAAGG - Intergenic
1109501880 13:63248481-63248503 CTACTATCTTTGGCAAAGAAAGG + Intergenic
1109658566 13:65428007-65428029 CTACTATTCATGAAAAAGAAAGG - Intergenic
1109763093 13:66856876-66856898 CTTTTTACCTTGAAAAGGAATGG + Intronic
1109864125 13:68239773-68239795 CTACTTTCCTTGAAAATCAATGG + Intergenic
1109971876 13:69781206-69781228 CTACCTTTCCTGAAAAGGAAAGG + Intronic
1110478524 13:75946551-75946573 CTTCTTTTCTTGGAAAAGCATGG + Intergenic
1110543715 13:76733812-76733834 CAACATTCCTTGAAAACAAATGG + Intergenic
1110939672 13:81333309-81333331 CTACTTTCTTTTAAAAAGGAGGG + Intergenic
1111260227 13:85728132-85728154 CTACTTTAAAAGAAAAAGAATGG - Intergenic
1111619936 13:90712231-90712253 CTTCTTTGCTTAAAAAACAAGGG - Intergenic
1111728103 13:92038759-92038781 CTCAATACCTTGAAAAAGAATGG + Intronic
1115007330 14:28501019-28501041 CCATTTTTCTTGAAAGAGAAAGG - Intergenic
1115370888 14:32613316-32613338 CTAATTCCCTTAAAAATGAATGG - Intronic
1115645002 14:35362910-35362932 TTACTTTGCTTGATAATGAAAGG - Intergenic
1115715133 14:36095039-36095061 CTCCTTTTGTTGAAAAATAAAGG - Intergenic
1115900244 14:38139036-38139058 TTTCTTTCCTTAAAAAATAAGGG + Intergenic
1116521265 14:45850015-45850037 GGGCTTTCCATGAAAAAGAAAGG + Intergenic
1116598740 14:46889955-46889977 CTATATTCCCTGATAAAGAAAGG - Intronic
1117232660 14:53737097-53737119 CTACGTTCCTTAAAACAGGATGG - Intergenic
1117287516 14:54301293-54301315 CTACTTGCCTTTAAAAGGAAAGG - Intergenic
1117514673 14:56488933-56488955 CCACTTTATTTGGAAAAGAAGGG + Intronic
1118789511 14:69077169-69077191 CTCATTTCCCTGAAAAAGAAAGG + Intronic
1119274500 14:73341406-73341428 CTACTGTTCTCTAAAAAGAAAGG - Intronic
1119350907 14:73964699-73964721 CTACTTTTGTTGACAAAGATGGG + Exonic
1119436600 14:74601492-74601514 CCACGTTCCCTGAAAAGGAAAGG + Intronic
1123958721 15:25370333-25370355 ATGCTATCTTTGAAAAAGAATGG - Intronic
1124826573 15:33102276-33102298 CTTCTTTCATTGAAAATTAAGGG - Intronic
1125115804 15:36090172-36090194 CTATTTTCCCTCAAAAACAAAGG + Intergenic
1125259276 15:37803600-37803622 CTACCTTCCAGGAAAAAGGAGGG - Intergenic
1126115834 15:45206833-45206855 GTACTTTTCCTGGAAAAGAAAGG + Intergenic
1126545624 15:49871039-49871061 CTACTTATCTTTACAAAGAAGGG + Intronic
1126687260 15:51259245-51259267 TTTTTTTCCTTGAAAAATAATGG + Intronic
1127362261 15:58254639-58254661 CTGGTGTCCTTGTAAAAGAAAGG - Intronic
1127532226 15:59854737-59854759 CTAATTTCCTTTTAAGAGAACGG + Intergenic
1127912226 15:63426755-63426777 CTGCTGGCCTTGAAATAGAAGGG - Intergenic
1127953918 15:63835844-63835866 GTCCTTTTCTTGAAATAGAATGG - Intergenic
1128439549 15:67692162-67692184 CTACTTTTCCTGAAAAACTAGGG + Intronic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1130583106 15:85155954-85155976 CTTCTTTCTTTGAAGAAGATGGG - Intergenic
1130865060 15:87926240-87926262 CTACTTTTCTGTAAAATGAAAGG - Intronic
1131119763 15:89814869-89814891 TTACTTCCCTTTAAAAAGACGGG - Intronic
1131586046 15:93693893-93693915 CTAGTGTCCTTGTAAAAGAGTGG + Intergenic
1131669633 15:94606145-94606167 CCATTTTCTTTGAAAGAGAAAGG + Intergenic
1133544683 16:6794375-6794397 CTACACTCTTTGAAAAAAAATGG + Intronic
1134184756 16:12076071-12076093 CCCCTTTCCTTGAACAGGAAAGG + Intronic
1135560089 16:23469503-23469525 CCACTTCCCTTGAAAAGGGATGG + Intronic
1135988053 16:27198735-27198757 CTGCTTTTCATGAAAAAGAAAGG - Intergenic
1138040375 16:53657584-53657606 CTACTTTCACTAAAAAGGAAAGG + Exonic
1138424472 16:56921603-56921625 GTCCTTTCCTGGAAAAAGACAGG + Intergenic
1138780390 16:59778222-59778244 CTAGTTTCCTTGAAATTGAATGG - Intergenic
1138896796 16:61215567-61215589 CTATTTTCCTGGAATATGAATGG - Intergenic
1139132522 16:64163526-64163548 CTTCCATCCTTGAAACAGAAAGG - Intergenic
1139388230 16:66588229-66588251 CACCTTTGCTTGGAAAAGAATGG + Exonic
1139454763 16:67064778-67064800 TTTATTTACTTGAAAAAGAATGG + Intronic
1140343757 16:74192007-74192029 CTACGTTGCTTGACAAAGCATGG + Intergenic
1140770821 16:78202357-78202379 CTACGTACCTGGAAAAGGAAGGG - Intronic
1141127580 16:81411842-81411864 ATACTTTCTTTTAAAAAGCATGG - Intergenic
1141450383 16:84095906-84095928 CCACTTTCCTTCAAACAGAGTGG - Intronic
1145834581 17:27944615-27944637 CTAGTGTCCTTATAAAAGAAAGG + Intergenic
1147499871 17:40952608-40952630 CAGCTTTCTTTTAAAAAGAAAGG + Intergenic
1151040139 17:70850008-70850030 TTACTTTCATTGAAAAATAAAGG + Intergenic
1152943894 17:83188223-83188245 CTACCTTTCATGAAAAAGGAAGG + Intergenic
1153239737 18:3020095-3020117 ATATTTTCCTTGAAAAAAAGGGG + Intergenic
1154033700 18:10777622-10777644 CTACTTTCCATTAAAGAAAATGG + Intronic
1154185795 18:12181864-12181886 CTCCTTTCCTTGACCAGGAAAGG - Intergenic
1155468066 18:26161180-26161202 CTAGTTCCCAAGAAAAAGAAGGG - Intronic
1156686125 18:39648959-39648981 TTACTTTCCTAGAATACGAAAGG - Intergenic
1157030715 18:43904165-43904187 CTGTTTTCCATGGAAAAGAAAGG - Intergenic
1157325033 18:46662823-46662845 CTAGTTACCTTGAGAAATAAGGG - Intergenic
1157356346 18:46938404-46938426 TTTCTTTCTTTAAAAAAGAAAGG + Intronic
1157969757 18:52253056-52253078 CTTTTTTCCCTGAAAAAGAAGGG - Intergenic
1158344450 18:56501771-56501793 CTCCCTTCATTGAAGAAGAAGGG + Intergenic
1158726487 18:59977836-59977858 CCACTTTTAATGAAAAAGAAAGG - Intergenic
1159536245 18:69718581-69718603 CTATTTAGCTTAAAAAAGAAAGG + Intronic
1159790447 18:72772675-72772697 CCACCTTCCATGAGAAAGAAAGG - Intronic
1161450201 19:4341551-4341573 TTAATTTTCTTGTAAAAGAAGGG - Intronic
1163890550 19:20008577-20008599 CTCCTTTGCTTGCAAAAGTAAGG - Intronic
1165186300 19:34025346-34025368 TGAGTTTTCTTGAAAAAGAAAGG + Intergenic
925870557 2:8266128-8266150 CTACTTCCCTAGAAAAAGGCGGG + Intergenic
926133262 2:10318803-10318825 TTATTTTCCTTTAAAAAGGATGG - Intronic
927224617 2:20751212-20751234 CTTTTTACCTTTAAAAAGAAAGG - Intronic
928489901 2:31771313-31771335 CTACCTTCTTTGAAAGAGATGGG - Intergenic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
931127507 2:59294378-59294400 TTTCTTTCCTTGAAAAATTAAGG + Intergenic
931797451 2:65724708-65724730 CTACTTACCTTGAAAATTATGGG + Intergenic
932504695 2:72217306-72217328 CCATTTTACTTGAAAAAGGAGGG + Intronic
933104678 2:78309452-78309474 CTACTTTTTTTATAAAAGAAAGG - Intergenic
933256605 2:80088039-80088061 CACCTTTCCATGAACAAGAAGGG - Intronic
933460797 2:82582344-82582366 TTACTTTCCCTTAAAAATAAGGG - Intergenic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
935618045 2:105105367-105105389 CTGGTTTCCTTGAAAATGAATGG + Intergenic
936418324 2:112340167-112340189 AGACTTTCCTGGAAAAAAAAGGG + Intergenic
937534984 2:122875232-122875254 CTCCTTCCCTTGAGAATGAATGG - Intergenic
938676955 2:133646493-133646515 AAACTTTCCTTCAAAAATAAAGG + Intergenic
939218009 2:139265074-139265096 CTAGTTTCCTTGTAGAAAAATGG + Intergenic
939388690 2:141537028-141537050 CTAGTTTCCTTTGAAAAGCAGGG - Intronic
939914827 2:148026387-148026409 CTACATTCCTTATAAAAGACTGG - Intronic
940235134 2:151503269-151503291 TTACTTTCTTTAAAAAAGATGGG + Intronic
941409014 2:165129640-165129662 TTACTTTCTTTGAAGAAGAAAGG + Intronic
941783606 2:169475601-169475623 CTACCTTCCATGAAAAAGCAAGG - Intergenic
941856492 2:170236256-170236278 ATATTTTCTTTGAAAAAGCAAGG + Intronic
942778897 2:179617346-179617368 ATTCTTCCTTTGAAAAAGAAAGG - Intronic
943274994 2:185855214-185855236 CTACTTTCCATGAAACACCAGGG + Intergenic
944388548 2:199191988-199192010 CAACTTTTTTTTAAAAAGAAAGG + Intergenic
945121117 2:206458334-206458356 TTTCTTTCATTAAAAAAGAAAGG + Intronic
945994911 2:216428354-216428376 CTACATTCTTTCAAAAAGCAAGG + Intronic
948036467 2:234862262-234862284 CCACTGTCCTTAAGAAAGAAAGG + Intergenic
1169103991 20:2978573-2978595 CTTCTTTCCTTGAAAACAAAGGG - Intronic
1170297533 20:14844667-14844689 CTTCTTTCTCTCAAAAAGAAAGG + Intronic
1171102954 20:22403328-22403350 CTCCTTTTGTTCAAAAAGAATGG - Intergenic
1171958386 20:31476396-31476418 CTTCTTTCCTTCTGAAAGAAGGG - Exonic
1172642023 20:36446267-36446289 TTTCTTTCCTTGTAAAATAAAGG + Intronic
1172943896 20:38673669-38673691 CTTCACGCCTTGAAAAAGAACGG + Intergenic
1177196350 21:17907549-17907571 CTGATTTCCTTGAATATGAATGG - Intronic
1177227858 21:18280719-18280741 CTATTTTTCATGTAAAAGAAAGG - Intronic
1177228136 21:18284164-18284186 CATCTTTCCTTCAAAGAGAAAGG + Intronic
1177389263 21:20445551-20445573 ATACTTTTCTTGAATAATAAGGG + Intergenic
1178002088 21:28173516-28173538 CTTCTTTCCTTTAAAATGCAGGG + Intergenic
1178124498 21:29502273-29502295 CTTCTTTCCTTGAACATGAAAGG - Intronic
1178226690 21:30727419-30727441 CGAATTTCATTTAAAAAGAACGG + Intergenic
1178967738 21:37139196-37139218 CTGTTTTCCTAGAAAAACAAAGG + Intronic
1179434729 21:41352402-41352424 GTACCTTCCCTGAGAAAGAAAGG + Intronic
1181765844 22:25091362-25091384 CACCTTTGCTTGAAATAGAATGG - Intronic
1184704592 22:46201924-46201946 CTGCCTGCCTTAAAAAAGAAAGG - Intronic
1184756832 22:46521057-46521079 CTACTTAGCCTGAAAAAGGACGG - Intronic
1184881492 22:47307262-47307284 CTTATTTCACTGAAAAAGAAGGG + Intergenic
950912342 3:16607118-16607140 CTACTTACCTTGAATAAGAATGG + Intronic
951235086 3:20225655-20225677 CTACTTTTGTTGAAAAAGTATGG - Intergenic
953403132 3:42644265-42644287 CTTCTTTCTTTCCAAAAGAAAGG - Intronic
953418495 3:42736520-42736542 CCACTTTCAATGACAAAGAATGG + Intronic
954460160 3:50621932-50621954 CTACTCTCCTTAACAAAGAAGGG - Intronic
954870296 3:53762805-53762827 CTCCTTCCCCTGAAAAAGAGTGG + Intronic
955102434 3:55863504-55863526 TCAGTTTCCTTGAAAAAGGAAGG - Intronic
955617180 3:60821637-60821659 CTACATTTCATGGAAAAGAAGGG + Intronic
958900933 3:99886057-99886079 CCACCTTCCTTGATATAGAAAGG - Intronic
959302465 3:104620485-104620507 CTATTTTACTGGAAAAAAAAAGG + Intergenic
960388243 3:117047157-117047179 ATATTTTCTTTGAAAAAAAATGG + Intronic
960946751 3:122972230-122972252 CTACTTTCCTGGAAAAGCAGGGG - Intronic
963819859 3:149877997-149878019 TTACCTTCCTGGTAAAAGAAGGG - Intronic
964071303 3:152636769-152636791 CCAGTTTCCTTTCAAAAGAAGGG + Intergenic
964204447 3:154157328-154157350 GCACTTTCCTTGAAATGGAAAGG + Intronic
964558811 3:157970300-157970322 CTACCTTCCATGCAAAAGAGAGG + Intergenic
965512699 3:169586163-169586185 CTACTTTACTTGCAAAGAAATGG - Intronic
965629638 3:170718882-170718904 CCATTTTCCTGGAAAAAAAAAGG - Intronic
965774370 3:172213095-172213117 ATCCTCTCTTTGAAAAAGAAGGG - Intronic
966449722 3:180044087-180044109 ATTCTTTACTTGAAAAAGCAGGG - Intergenic
967613112 3:191531958-191531980 TTATTTTGTTTGAAAAAGAAAGG - Intergenic
967857341 3:194128316-194128338 CTATATTCTCTGAAAAAGAAGGG - Intergenic
969136230 4:5031351-5031373 TTACTTTCCTTGGAAAATGAGGG + Intergenic
971927964 4:33038536-33038558 CTTCTTTCATTGTAACAGAAGGG + Intergenic
972041324 4:34603840-34603862 CTATTTTTCATTAAAAAGAAAGG + Intergenic
972187600 4:36550488-36550510 ACACTTCACTTGAAAAAGAAAGG + Intergenic
973674241 4:53248135-53248157 CCCCTTTCCTTGACCAAGAAAGG - Intronic
973773377 4:54226084-54226106 CTACTTTCCTTGAAGAATTCAGG - Intronic
975815375 4:78211375-78211397 ATACTGTCATTGAAAAAGCAGGG + Intronic
976110191 4:81664640-81664662 CTACTTTCCTTCCCAAACAATGG - Intronic
976546152 4:86337945-86337967 CTACTTTCCTTAAGATATAATGG + Intronic
976812837 4:89115225-89115247 CTATTTTCCTGGAACAGGAATGG - Intergenic
976880820 4:89922909-89922931 CTCCTTTCCGTGAAAAGGGATGG - Intronic
976926754 4:90507685-90507707 CTACCTTGATTAAAAAAGAATGG - Intronic
977842311 4:101723356-101723378 CTACTTTCATTTAGAAATAAAGG + Intronic
978383369 4:108154478-108154500 TTTTTTTGCTTGAAAAAGAAGGG - Intronic
979786698 4:124723790-124723812 CTACCTTTTATGAAAAAGAAAGG + Intergenic
979958505 4:126987060-126987082 CTACTTTCCTGGTAAAAGCTAGG + Intergenic
980893797 4:138841734-138841756 CTATTACCCTAGAAAAAGAATGG - Intergenic
981404616 4:144353727-144353749 CTCCCTGCCCTGAAAAAGAAAGG + Intergenic
981612948 4:146615233-146615255 CTGCTTTTTTTGGAAAAGAAAGG + Intergenic
981867484 4:149441523-149441545 CTACTTTTCATGAAAAAAGAAGG - Intergenic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982288003 4:153754683-153754705 CTAGTGTCCTTGCAAGAGAAAGG + Intronic
982385359 4:154795353-154795375 CTAATTTCCTTAAAATAAAAAGG - Intronic
982755813 4:159217488-159217510 CTACTAGCCTTAAAAAAGAATGG - Intronic
982956074 4:161768270-161768292 CTACCTTCCTTAAAAATGAATGG + Intronic
982956080 4:161768316-161768338 CTACCTTCCTTGAAAACGAATGG - Intronic
982961890 4:161849610-161849632 CTTCTTTGCTTAAAAATGAATGG + Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983411176 4:167400108-167400130 ATAGATTCCTTGAAACAGAATGG + Intergenic
983671993 4:170248107-170248129 CTACTATCCCTGAGAAAGCAAGG - Intergenic
983940744 4:173531964-173531986 CCCCTTTCCTAGAAAAAGAATGG - Intergenic
983948114 4:173608958-173608980 CTCCTTTCCTTGACCAGGAAAGG + Intergenic
984080812 4:175247411-175247433 ATACTTGCCTTGCAAAAGACTGG - Intergenic
984112084 4:175629227-175629249 CTATTTTCCTTAAACAAGCATGG - Intergenic
984409116 4:179372178-179372200 CTACCCTCCATGAAAAAGGAAGG - Intergenic
984512609 4:180697202-180697224 CAACTTTCCTTGGAAAATATTGG + Intergenic
985077335 4:186229014-186229036 CTTTTTTCCTGGAAAAAAAAAGG - Intronic
985234966 4:187862672-187862694 CTCCTTTCCTTGACCAGGAAAGG + Intergenic
986118715 5:4807917-4807939 CAAATTTCCTTCAAAAACAAAGG - Intergenic
986573031 5:9184768-9184790 TTACTTTGCTTGGAAAAAAAAGG - Intronic
986584920 5:9305797-9305819 GAACTTCCCTTAAAAAAGAAGGG - Intronic
987270691 5:16305244-16305266 GAACTTTCCTTGATAAAGATAGG - Intergenic
987646029 5:20673092-20673114 TTACTTACCTTGAGAAATAATGG + Intergenic
988616370 5:32779050-32779072 CTACTTTACCAGAAACAGAATGG - Intronic
991246529 5:64514167-64514189 CTACTGTCCTTGTAAAAAAGAGG - Intronic
991430092 5:66535373-66535395 ATAGGTCCCTTGAAAAAGAATGG + Intergenic
991492721 5:67198646-67198668 TTACTTTCCTTCTTAAAGAAAGG + Intergenic
991683555 5:69161675-69161697 GTAGTTTCCTTGAAATACAATGG + Intergenic
992635382 5:78721320-78721342 CTTATTTTCTTGAAAAAGGATGG + Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993638457 5:90373580-90373602 CCACATTCCTGGAAGAAGAATGG + Intergenic
994600142 5:101892384-101892406 ATACTATCCTTAAAAAAGAGGGG - Intergenic
995659521 5:114465304-114465326 TTACTTTGCTTAAAAAAGAGAGG + Intronic
995673231 5:114631912-114631934 GTACTTCCCTGTAAAAAGAAGGG - Intergenic
996860267 5:128057826-128057848 GTACTTTCCTTCAAAAATAAAGG + Intergenic
996888463 5:128388331-128388353 ATATTATCCTTGAAAATGAACGG - Intronic
997073672 5:130646352-130646374 CTACTTCCCTTCAAAAAGATAGG - Intergenic
997085785 5:130796890-130796912 TTACTTTTTTTAAAAAAGAAAGG - Intergenic
999683142 5:154078436-154078458 CTAATTTCCATGATAAAGAGGGG - Intronic
1000181460 5:158815843-158815865 TGTCTTTCCTTGAAATAGAAAGG - Intronic
1000726989 5:164783789-164783811 CTACTTTAGATGAAAAAAAATGG + Intergenic
1000753133 5:165121985-165122007 CTGCTTTCCTTTAAAAACAAAGG - Intergenic
1001104460 5:168841251-168841273 CTACTTTTTTTGTAAAAGCAGGG + Intronic
1001248380 5:170123877-170123899 CTTGTTTCCCTGAACAAGAAAGG - Intergenic
1001500760 5:172231751-172231773 ATATTTTCCTTGAAAAACAGAGG + Intronic
1003020999 6:2509474-2509496 GTACATTCCTTGAAATAAAATGG + Intergenic
1003076872 6:2989788-2989810 GTGCTTTCCTTGGGAAAGAACGG + Intronic
1005062843 6:21793167-21793189 TTACATTCCTTAAAAAAGCATGG - Intergenic
1005798895 6:29398322-29398344 ATATTTTCTTTAAAAAAGAATGG + Intronic
1005806637 6:29479388-29479410 CCAGTTTCCTGGAAAAAGGAGGG - Intergenic
1006389994 6:33752568-33752590 CTCCTCTCCTGGAAAATGAAAGG - Intergenic
1007368842 6:41413166-41413188 CTCCTTTTCTTGAAAAAAAGGGG - Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1008138922 6:47809295-47809317 CTTCTTCCCTTGAATAAGTAAGG + Intronic
1009556207 6:65171272-65171294 GTATTTTCATGGAAAAAGAAAGG - Intronic
1009763092 6:68034137-68034159 TTAATTTCCTTAAAAAATAATGG + Intergenic
1010761074 6:79723969-79723991 CTACTCTACTGGACAAAGAAAGG - Intergenic
1011429166 6:87266925-87266947 CTACTATTCTTGAAAAAATAGGG + Intergenic
1011602583 6:89073740-89073762 TGACTTTCCTTGTGAAAGAAGGG + Intergenic
1011646756 6:89466326-89466348 TTACTTTCCTTGAAGAGAAATGG + Intronic
1011720598 6:90152146-90152168 CTGCTGTCCATGACAAAGAAAGG + Intronic
1012394533 6:98780926-98780948 TTGCTCTCATTGAAAAAGAAAGG - Intergenic
1012592238 6:100996356-100996378 CTTCTTTCCCTGTTAAAGAAAGG - Intergenic
1013138028 6:107301196-107301218 CTCCTTTCCTTGAAAAGCAGTGG + Intronic
1013494439 6:110684411-110684433 TTTCTCTCCTTGAAATAGAATGG + Intronic
1014090372 6:117397775-117397797 CTACTTAAGTGGAAAAAGAAAGG + Intronic
1015051661 6:128848221-128848243 CTGATTTACATGAAAAAGAAAGG + Intergenic
1015118344 6:129674318-129674340 CTTCCTTCCTTGAAAACCAAGGG + Intronic
1015284624 6:131471359-131471381 CAACTTTCATTGAAAAATTAAGG + Intergenic
1015312959 6:131784810-131784832 CTGCTGTCCTTATAAAAGAAGGG - Intergenic
1016121339 6:140345548-140345570 CTACCTTCCTTGAATCTGAATGG + Intergenic
1016724292 6:147343471-147343493 TTTCTTTTCTTGAAAAATAAAGG - Intronic
1016869181 6:148799522-148799544 ATACATTCCCTGAACAAGAAGGG - Intronic
1017232878 6:152091825-152091847 GTGATTTCCTTGAACAAGAAAGG + Intronic
1018200397 6:161389159-161389181 CTCCTTGCCTCAAAAAAGAATGG + Intronic
1018791930 6:167155203-167155225 TTTCTTCCCTTGAAACAGAAAGG - Intronic
1020190506 7:5993513-5993535 CTATTTTCCTAGGAAAATAAGGG - Intronic
1020853306 7:13384848-13384870 GTATTTTCTTTGGAAAAGAAAGG - Intergenic
1024188970 7:46985877-46985899 CTACCTTTCATGAAAAAGGATGG - Intergenic
1026746382 7:73016500-73016522 CTACATTCCTTCAACCAGAAGGG - Intergenic
1026750033 7:73044643-73044665 CTACATTCCTTCAACCAGAAGGG - Intergenic
1026753681 7:73072753-73072775 CTACATTCCTTCAACCAGAAGGG - Intergenic
1026757332 7:73100789-73100811 CTACATTCCTTCAACCAGAAGGG - Intergenic
1027032485 7:74901058-74901080 CTACATTCCTTCAACCAGAAGGG - Intergenic
1027090072 7:75292697-75292719 CTACATTCCTTCAACCAGAAGGG + Intergenic
1027093717 7:75320625-75320647 CTACATTCCTTCAACCAGAAGGG + Intergenic
1027097360 7:75348592-75348614 CTACATTCCTTCAACCAGAAGGG + Intergenic
1027321987 7:77019080-77019102 CTACATTCCTTCAACCAGAAGGG - Intergenic
1027325621 7:77047000-77047022 CTACATTCCTTCAACCAGAAGGG - Intergenic
1027775932 7:82464077-82464099 ATATCTTCCTTGAGAAAGAAAGG + Intergenic
1028018162 7:85740533-85740555 CTACTCTCCTTGATAAAGGTGGG + Intergenic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028577924 7:92373001-92373023 TTACTATACTTGCAAAAGAATGG + Intronic
1028879451 7:95863645-95863667 CTAGTTACCTTGAAAAATAAAGG - Intronic
1029046358 7:97633185-97633207 CTCCTTTGCAGGAAAAAGAAGGG + Intergenic
1029059805 7:97785833-97785855 CTGCTTTCCTTGACTAGGAAAGG - Intergenic
1029398467 7:100325586-100325608 CTACATTCCTTCAACCAGAAGGG + Intergenic
1030444423 7:109631507-109631529 TTACATACCTTGAAAAATAATGG + Intergenic
1031225697 7:119035220-119035242 CTTTTTTCCTTAAAAAAAAAAGG - Intergenic
1031357252 7:120801882-120801904 CTTATTTCCTGGAAAAAAAATGG + Intronic
1031416566 7:121502999-121503021 CTACTTTTCATTAAAAAGAAAGG - Intergenic
1031871593 7:127093983-127094005 ATAGTTTCCTTGAAAATAAATGG - Intronic
1032225461 7:130027866-130027888 TTACTTTCTTTGAAAAATGATGG + Intronic
1032354682 7:131199548-131199570 CCACTTCCCTTGGAGAAGAAAGG + Intronic
1032378165 7:131445381-131445403 CTTCTTTTTTTGAAAAACAAAGG - Intronic
1033822880 7:145155244-145155266 CTACTTTCCTTGACTGTGAACGG - Intergenic
1036012378 8:4741144-4741166 CTAGTGTGCTTGAAAAAGAAGGG - Intronic
1036419473 8:8582663-8582685 ATTCTTTCCTTTAAAAATAATGG - Intergenic
1036609058 8:10334247-10334269 TTAATTTCCGTGGAAAAGAAAGG + Intronic
1037055706 8:14438848-14438870 TTATTTTCCTTGAAAATGACAGG - Intronic
1037205527 8:16315013-16315035 TTTCTTCCCTGGAAAAAGAAAGG - Intronic
1037512886 8:19601840-19601862 CGTCTTTCCTTGAAATAGGAAGG + Exonic
1038062986 8:23932636-23932658 CTATATTGCATGAAAAAGAAAGG - Intergenic
1038783383 8:30588382-30588404 CTATTAGCCTTAAAAAAGAAAGG + Intronic
1039285818 8:36039804-36039826 ATACCTTCCGTGAAAAAGAAAGG + Intergenic
1039677211 8:39682459-39682481 CTACCTTTCCTGAAAAAGGAAGG + Intronic
1039849215 8:41347811-41347833 CTTTTTTCCTTGAACAAGAGTGG - Intergenic
1039927585 8:41950914-41950936 TTACTTTTCTGGAAACAGAAGGG + Intronic
1040362130 8:46675891-46675913 CTACTTGGCTACAAAAAGAATGG + Intergenic
1040395097 8:46991159-46991181 CTGCTTTCTTTGAAAAAACAAGG - Intergenic
1041200356 8:55447889-55447911 TTACGTTCCTTTAAAACGAATGG - Intronic
1041596460 8:59659679-59659701 CAACTATGCTTGACAAAGAAAGG + Intergenic
1041754473 8:61298963-61298985 CTGCTTTCCTAGTAAAAGAATGG + Intronic
1043159180 8:76824477-76824499 TTTTTTTCCTTGCAAAAGAAGGG - Intronic
1045035750 8:98175353-98175375 TTACTTGGCTTTAAAAAGAAAGG + Intergenic
1045182026 8:99794573-99794595 CTACTTTTCATGGAAAAGAATGG - Intronic
1045979055 8:108162539-108162561 CTACTTTCTTAAGAAAAGAAAGG - Intergenic
1046802236 8:118441122-118441144 GTTGTTTCCTTGACAAAGAAAGG + Intronic
1047038799 8:120969944-120969966 CTTCCTCCTTTGAAAAAGAAAGG - Intergenic
1047124067 8:121940713-121940735 CTCCTTTCCATAAAAAAAAAAGG + Intergenic
1047171950 8:122502375-122502397 GTATTTTCCTGGAGAAAGAAAGG + Intergenic
1047339222 8:123964321-123964343 CAACTTTGAGTGAAAAAGAAAGG - Intronic
1049058366 8:140256772-140256794 CTGCTTTACTTGTAAAAGAAGGG - Intronic
1050517410 9:6459244-6459266 CCATTTTCCCTGAAAGAGAAAGG - Intronic
1050958910 9:11702297-11702319 TTACGTTCCTTAATAAAGAAAGG + Intergenic
1051385682 9:16506317-16506339 GGACTTTCCTTGACAAATAATGG - Intronic
1055010037 9:71555071-71555093 CTATTTTGCTTGAAACAGAAGGG + Intergenic
1055983383 9:82029559-82029581 ATACTTTCATTAGAAAAGAAAGG - Intergenic
1056878242 9:90359761-90359783 CTACTTGTCATTAAAAAGAAAGG - Intergenic
1057353695 9:94319213-94319235 CTCCTGTCCTTGAAGGAGAAAGG - Exonic
1057627450 9:96690302-96690324 TTATTTTCCTTTAAACAGAACGG - Intergenic
1057654055 9:96938379-96938401 CTCCTGTCCTTGAAGGAGAAAGG + Exonic
1058239207 9:102535229-102535251 CTACTTTCATTGAAATGGAATGG - Intergenic
1058944526 9:109843700-109843722 CCACTTTCCTTTAATAAGCAAGG - Intronic
1059821622 9:117979540-117979562 TTACTTTCCTTTAAAAGGATTGG - Intergenic
1060451049 9:123740470-123740492 CTACTTTCCCTGAATGAGCAAGG + Intronic
1060620312 9:125059304-125059326 GTACTTTCCTTCAAAGACAAGGG + Intronic
1186353697 X:8767850-8767872 GTACTTTGCTTGGAAAAAAATGG + Intergenic
1188595590 X:31896043-31896065 CTTCTTTCCCTGAAAAAGTTTGG + Intronic
1189530141 X:41871886-41871908 CTACTCTCCTTGAAAACAGAGGG + Intronic
1189584870 X:42448800-42448822 CTAATTTGCTTGAAAAATGATGG - Intergenic
1189789330 X:44588514-44588536 CTACCTTTCCTGAAAAAGAAAGG + Intergenic
1190406330 X:50091402-50091424 CTATTTTTATTGGAAAAGAAAGG + Intronic
1190520053 X:51268694-51268716 AAACTATCCTTGAAAAATAAAGG + Intergenic
1190596515 X:52057231-52057253 CTAGATTGCATGAAAAAGAAAGG - Intergenic
1190612309 X:52196842-52196864 CTAGATTGCATGAAAAAGAAAGG + Intergenic
1190843218 X:54166065-54166087 CTAATTTCCTTAATAGAGAAGGG + Intronic
1191003564 X:55686939-55686961 CCCCTTTCCTAGTAAAAGAAAGG - Intergenic
1192715488 X:73637114-73637136 AAACTTTCCTTCAAAAATAAAGG - Intronic
1192829780 X:74739954-74739976 CTTTTTACTTTGAAAAAGAAGGG + Intronic
1193384512 X:80854690-80854712 CTACTTGGCTTCAAAAAGAAAGG - Intergenic
1194409023 X:93534095-93534117 CTACTTTCTCAGATAAAGAAAGG - Intergenic
1194938701 X:99983077-99983099 TTACTTTCCAGGTAAAAGAATGG - Intergenic
1195299446 X:103512946-103512968 CAACTTTCCTTGAAAAGGGCAGG - Intronic
1195497771 X:105557585-105557607 TCACTTTCCTTGAAATAGAAGGG + Intronic
1196700308 X:118660786-118660808 CTACTTTATTTGAACAAAAATGG + Intronic
1196961512 X:121008027-121008049 CTTGTTTACTTGAGAAAGAATGG + Intergenic
1197526625 X:127572205-127572227 CTATTTTTGTTGCAAAAGAAAGG - Intergenic
1198573610 X:137986007-137986029 TTACTTTCCTTCAGAAAGTATGG + Intergenic
1199068443 X:143447745-143447767 CTACTTTAGTTGAAACAGAGAGG - Intergenic
1200720087 Y:6595829-6595851 CTATTTTCCTTAAACCAGAAGGG - Intergenic
1201297741 Y:12478906-12478928 CCTCTTTCCTAGAAAAAGTAAGG + Intergenic
1201426042 Y:13851834-13851856 CCACTTTCCTTGACCAGGAAAGG + Intergenic
1201678423 Y:16615104-16615126 TTACTCTCCTTGAAAAGGCATGG + Intergenic
1202282177 Y:23200667-23200689 CTACTTATCTTGAATAAGAATGG + Intergenic
1202283714 Y:23217852-23217874 CTACTTATCTTGAATAAGAATGG - Intergenic
1202433849 Y:24815052-24815074 CTACTTATCTTGAATAAGAATGG + Intergenic
1202435390 Y:24832238-24832260 CTACTTATCTTGAATAAGAATGG - Intergenic