ID: 1028549035

View in Genome Browser
Species Human (GRCh38)
Location 7:92036445-92036467
Sequence CTACAAAAACATTTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028549035_1028549038 27 Left 1028549035 7:92036445-92036467 CCCAGCTACAAATGTTTTTGTAG 0: 1
1: 0
2: 1
3: 25
4: 264
Right 1028549038 7:92036495-92036517 TCATTGATCATCTTGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028549035 Original CRISPR CTACAAAAACATTTGTAGCT GGG (reversed) Intronic
903290474 1:22310673-22310695 CTACAAAAACATTTTTAAAAAGG - Intergenic
903831196 1:26176251-26176273 CAAAAAAAAAATTTGGAGCTGGG - Intergenic
904765633 1:32844363-32844385 TTAGAAAAACATTTGGAACTGGG + Intronic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
909283528 1:73787062-73787084 CTACAAAGGCATTTGTCCCTTGG - Intergenic
910344369 1:86218944-86218966 AAACAAAAACATATGTGGCTGGG + Intergenic
912099541 1:106189160-106189182 CTACAAAGACATATGCAGCCGGG + Intergenic
912690397 1:111800662-111800684 CTACAAGGACATTTGTACTTTGG + Intronic
912737532 1:112163415-112163437 CTACAAAAATATTAGAAGCTAGG + Intergenic
914254297 1:145948602-145948624 CTCCAAAAACATTTATACCCAGG - Intronic
916657134 1:166886201-166886223 CTACAAAACAATTGGTAACTTGG - Intergenic
917841262 1:178981033-178981055 CTACAAAAAAATAATTAGCTGGG - Intergenic
918939721 1:190976893-190976915 CTTCAAAGACAATTGTAGCTAGG + Intergenic
919230820 1:194771691-194771713 CTACAAAAACAAAATTAGCTGGG - Intergenic
919725378 1:200879167-200879189 CTTTTAAAACATTTGCAGCTGGG - Intergenic
920854328 1:209651116-209651138 CAGCAGATACATTTGTAGCTTGG + Exonic
922535361 1:226376200-226376222 TTACAAAAAGATCTGTAGGTGGG - Intronic
922664852 1:227459944-227459966 CTACAAAAACAAATTTAGCCAGG + Intergenic
1064468282 10:15607992-15608014 ATTATAAAACATTTGTAGCTTGG - Intronic
1065069648 10:22009627-22009649 CTTTAAAAGCATTTGTTGCTGGG + Intergenic
1065504112 10:26411983-26412005 CTACAAAAAAATTTAAAGATTGG + Intergenic
1066481603 10:35800609-35800631 TGAGAAAAACGTTTGTAGCTTGG - Intergenic
1068139282 10:52984337-52984359 CTCCAAGAACACATGTAGCTAGG - Intergenic
1069094290 10:64239623-64239645 AAAAAAAAATATTTGTAGCTGGG + Intergenic
1069472715 10:68707048-68707070 CTAACAAAATATTTGAAGCTCGG + Intergenic
1071990827 10:91099349-91099371 CTACAAAAAAAATTTTAGCTGGG + Intergenic
1073097969 10:100991710-100991732 CTACAAAAATATTTGAAAATTGG + Intronic
1073241570 10:102062314-102062336 CTAAAAAAACAGTTGTGGCCAGG + Intergenic
1075323866 10:121514230-121514252 TTACAAAAGCATTTGAAACTTGG - Intronic
1078823739 11:14907034-14907056 CTAGAACAACATGTGGAGCTGGG - Intronic
1079900918 11:26183591-26183613 ATACAAAAAAATTAGTAGCTGGG + Intergenic
1081318852 11:41665878-41665900 CTTCAAAAACAAGTGTAGATGGG + Intergenic
1081473616 11:43401810-43401832 CTACAAAAACATATATAAATTGG + Intronic
1081705882 11:45181593-45181615 CAACAAAAACAGCTGTAGCCCGG - Intronic
1082965010 11:58958232-58958254 CTCCAAATACATTTGGAGTTGGG + Intronic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1084533306 11:69742146-69742168 ATACAAAAAAAATTTTAGCTGGG + Intergenic
1084638855 11:70412260-70412282 CTACAAAAACATAATTAACTGGG + Intronic
1085427404 11:76416654-76416676 ATACAAAGACATTTGGAGGTCGG + Intergenic
1085837203 11:79969906-79969928 CTACAAAAATAACTTTAGCTTGG - Intergenic
1086903028 11:92388932-92388954 CTTCAAATGCATTTGTTGCTTGG + Intronic
1088112126 11:106274346-106274368 CTACAAAAGCATTTGCAGCAAGG - Intergenic
1089715534 11:120355520-120355542 TTCCAAAAAAATTTATAGCTGGG - Intronic
1089960096 11:122609179-122609201 CTACAAAAATATGTATAGATAGG - Intergenic
1090064423 11:123491035-123491057 CTTAAAAGACATTTGTGGCTGGG + Intergenic
1090302164 11:125652118-125652140 TTACAAAAACTTTTGTAATTTGG + Intronic
1090543072 11:127730201-127730223 CTCCAAAAACATATGTAATTAGG + Intergenic
1092706007 12:11285614-11285636 ATAATAAAACAATTGTAGCTTGG + Intergenic
1094769816 12:33642211-33642233 CCAGGAAAACATTTGTACCTGGG - Intergenic
1095434915 12:42176804-42176826 ATACAAAAAAAAATGTAGCTAGG + Intronic
1096856082 12:54484222-54484244 CCACAAAAACACTTGCAACTGGG - Intergenic
1097136554 12:56861775-56861797 CTACAAAGACATTGGGAGTTAGG + Intergenic
1097259473 12:57708465-57708487 CTACAAAAAAATATTTAGCCAGG + Intronic
1097533422 12:60835078-60835100 CTTAAACAACATTTCTAGCTGGG - Intergenic
1098986502 12:77018141-77018163 TAACAAAATCATTTGTAGCAAGG + Intergenic
1100158707 12:91832448-91832470 CTACAATCTCATTTGAAGCTTGG - Intergenic
1103153922 12:118667221-118667243 CTACTAAAAAATATTTAGCTGGG + Intergenic
1103819917 12:123689349-123689371 CTACAGAAAAATTTTTGGCTGGG - Intronic
1105316128 13:19265534-19265556 CGACAAAATCATTACTAGCTGGG + Intergenic
1106929623 13:34650402-34650424 CTACAAAAACAAAATTAGCTGGG - Intergenic
1107605848 13:42055852-42055874 CTGGAAACACATTTGTAGCTGGG + Intronic
1108355946 13:49628794-49628816 CTTTAAAAACATATGTGGCTGGG + Intronic
1108390030 13:49937763-49937785 CTTAAAAAACATTTATAACTCGG - Intergenic
1109178159 13:59180920-59180942 CTACAAATACATTTTTATTTGGG - Intergenic
1110317716 13:74130494-74130516 CTACAAAAAAATTTTTAGCTGGG + Intronic
1112268541 13:97947904-97947926 CTGAAAAAATATTTTTAGCTGGG - Intergenic
1112979242 13:105361212-105361234 TTTCTAAAACATTTGTATCTTGG - Intergenic
1113454138 13:110435832-110435854 ATATAAAAACATCTTTAGCTGGG + Intronic
1114007392 14:18329987-18330009 CTAAAAACACATTTGCAGCCAGG - Intergenic
1114253405 14:20980966-20980988 CTACAAAAAAATTACTAGTTGGG + Intergenic
1114488999 14:23084447-23084469 ATACAAAAAAAATTTTAGCTGGG + Intronic
1115736371 14:36334895-36334917 CTCCAGAAACACTTGAAGCTGGG - Intergenic
1116681494 14:47976152-47976174 CTATAAAAATATTTGAGGCTGGG + Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117561039 14:56938935-56938957 ATAAAGAAACATTTGTAGGTAGG - Intergenic
1117779605 14:59218899-59218921 ATATAAAAACATTAATAGCTTGG - Intronic
1118027064 14:61780183-61780205 CTCCCAAAACATTGGCAGCTGGG - Intronic
1118840831 14:69509444-69509466 CTACAAAAAGATTTTTATCAAGG - Intronic
1118942682 14:70352768-70352790 GTACAAAAACAAATGTAGTTGGG - Intronic
1119250242 14:73146347-73146369 CTACAAAAAAATAATTAGCTGGG - Intronic
1120222062 14:81745602-81745624 CTAGCAATAAATTTGTAGCTGGG - Intergenic
1121053509 14:90835044-90835066 CATCAAAAACATTTGCAGCCAGG - Intergenic
1121932991 14:97990303-97990325 CTTAAAAAATATTTGTTGCTGGG - Intergenic
1121944762 14:98108933-98108955 CAACAAAAAGATTTGTATCTTGG + Intergenic
1123391314 15:19876653-19876675 CTAAAAACACATTTGCAGCCAGG - Intergenic
1125275192 15:37981519-37981541 TTAAAAAAACCTTTCTAGCTGGG + Intergenic
1125285630 15:38089548-38089570 CAACAAAAACATTTGGAGATTGG - Intergenic
1127168386 15:56271981-56272003 CTACAAAAACAAAATTAGCTGGG + Intronic
1127257030 15:57301245-57301267 CAAAAAAAAAAATTGTAGCTGGG + Intergenic
1130536864 15:84791991-84792013 CTACAGAAATATTTGCAGCAGGG + Intronic
1130798524 15:87236186-87236208 TTAAAAAAACATTTTTGGCTGGG - Intergenic
1132369123 15:101281057-101281079 CTACAAGAACATTTGTTGAAAGG - Intergenic
1133251313 16:4483541-4483563 CTCCTAAAACCTTTGTAGATGGG - Intronic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1133708929 16:8382353-8382375 CTACAAAGCCATCTGTAGCAGGG + Intergenic
1135087969 16:19489947-19489969 CTACAAAAAAATAATTAGCTGGG - Intronic
1135628838 16:24020036-24020058 TTACAAAAGCATTTGTACTTTGG + Intronic
1137540406 16:49357824-49357846 CTACAAAATCAACTGAAGCTCGG + Intergenic
1137690860 16:50426410-50426432 CTACAAAAAAATAATTAGCTTGG - Intergenic
1137691026 16:50427820-50427842 CTACAAAAAAATAATTAGCTTGG + Intergenic
1138772259 16:59679948-59679970 TTATAAAAACATTTATTGCTTGG - Intergenic
1139890878 16:70252640-70252662 CTACAAGAACATTTGAATCTTGG - Exonic
1141352034 16:83306793-83306815 CCACCAAAATATTTGAAGCTGGG + Intronic
1142784410 17:2209361-2209383 CAAAAAAAAAATTTTTAGCTGGG - Intronic
1145835072 17:27948803-27948825 AAACAAAAACATTATTAGCTGGG - Intergenic
1146984600 17:37203253-37203275 CTACAAAGACATTTTCAGCCAGG - Intronic
1147642576 17:42013100-42013122 CTATAAAAACATTTAAGGCTGGG - Intronic
1148274243 17:46289336-46289358 CTACAAAAAAAAAAGTAGCTGGG - Intronic
1150026461 17:61680358-61680380 AAACAAAAACATATCTAGCTAGG + Intergenic
1150663831 17:67111240-67111262 CTACAAAAAGTTTTTAAGCTGGG + Intronic
1153281238 18:3416222-3416244 AAAGAAAAACATTTGCAGCTGGG + Intronic
1153722069 18:7915078-7915100 CTACAAAACGATTTGTATCTTGG + Intronic
1154530080 18:15333954-15333976 CTAAAAACACATTTGCAGCCAGG + Intergenic
1155255019 18:23987867-23987889 GTACAAAAATATTTGAAGATGGG + Intergenic
1155748307 18:29389062-29389084 CTCCTAAAACATTTGCAGATAGG + Intergenic
1156276366 18:35586717-35586739 GTAAAAAAGCATTTGGAGCTGGG + Intronic
1156700700 18:39820948-39820970 CTGCAGAAACTTTTGTTGCTGGG - Intergenic
1157734796 18:50037733-50037755 CTACAAAAAAAGTATTAGCTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158681323 18:59569793-59569815 CTACAAAAACAAAATTAGCTAGG - Intronic
1159447188 18:68555558-68555580 TTGCAATTACATTTGTAGCTTGG - Intergenic
1161784453 19:6315050-6315072 CTACAAAAAAATAATTAGCTGGG - Intronic
1162950487 19:14069375-14069397 CTAAAAAAAGATGTTTAGCTGGG - Intergenic
1163363269 19:16861460-16861482 CTACAAAAAAATTTTTAAATTGG + Intronic
1163560298 19:18015261-18015283 CTACAAAAAAATAATTAGCTGGG - Intergenic
1164033321 19:21431328-21431350 CTATAGAGACAATTGTAGCTAGG - Intronic
1164689494 19:30199797-30199819 CTACATAAAAATGTGTAGCCTGG + Intergenic
1166848025 19:45742169-45742191 CTACAAAAAACTTTTAAGCTGGG - Intronic
925709305 2:6722706-6722728 GTACAGAAATAATTGTAGCTGGG - Intergenic
927339835 2:21970619-21970641 CTCAAAAAGCATTTGTAGGTAGG + Intergenic
928457336 2:31434413-31434435 TTAAACAAACATTTGTAGCCTGG - Intergenic
928898201 2:36289043-36289065 TAACACATACATTTGTAGCTTGG - Intergenic
928977476 2:37103841-37103863 CTAAAAAAACATTTTTGGCTGGG + Exonic
929327744 2:40637805-40637827 CTACAAAAATATTTTTAAGTGGG + Intergenic
931902962 2:66810311-66810333 CAACAAAAACTTTTCTAACTCGG - Intergenic
932931340 2:76043290-76043312 CTAAAATAAAATATGTAGCTGGG + Intergenic
934153248 2:89170607-89170629 CTACAAAAACCTTTAAATCTTGG + Intergenic
934213988 2:90011324-90011346 CTACAAAAACCTTTAAATCTTGG - Intergenic
938529176 2:132165396-132165418 CTAAAAACACATTTGCAGCCAGG + Intronic
941629121 2:167865052-167865074 CTGCATAAACATAGGTAGCTGGG - Intergenic
942324754 2:174766724-174766746 CAACCAAAACTTTTGTAGCCTGG - Intergenic
942546465 2:177069468-177069490 CTACAAAAACAAACTTAGCTTGG - Intergenic
943693413 2:190893878-190893900 CTAAAAATGCATTTGAAGCTGGG - Intronic
944836175 2:203582100-203582122 TTAAGAAAACATTTGTGGCTGGG - Intergenic
945045930 2:205781834-205781856 ATACAAATAAATTAGTAGCTAGG + Intronic
945513192 2:210728071-210728093 ATACAAAAATATTTATAGATAGG - Intergenic
945545805 2:211149815-211149837 CTACAAGAACAATTGAAGCATGG + Intergenic
946947998 2:224842532-224842554 CCAGAAAGGCATTTGTAGCTTGG + Intronic
1169820709 20:9706802-9706824 TTAGAAAAAAATTTGTAGGTTGG - Intronic
1173568903 20:44064322-44064344 CTACAATAACATATGAACCTAGG + Intronic
1173629741 20:44503223-44503245 CTGCAAAAAAATATGTAGCTGGG - Intronic
1175468093 20:59206703-59206725 CTACAACAACCTCTGAAGCTAGG + Intronic
1176767331 21:13034520-13034542 CTAAAAACACATTTGCAGCCAGG - Intergenic
1177453998 21:21311106-21311128 CTACACAAACATATCAAGCTGGG + Intronic
1178717309 21:34977695-34977717 CTACAAAGATATTTGGAGCTTGG + Intronic
1179554925 21:42166605-42166627 GTACATAAATATTTGTAGTTGGG - Intergenic
1179914900 21:44470352-44470374 ATACAAAAACATTTTAGGCTTGG - Intergenic
1180431899 22:15260795-15260817 CTAAAAACACATTTGCAGCCAGG - Intergenic
1180797610 22:18614215-18614237 CTACAAAAAAAATTTTAGCTGGG + Intergenic
1181224108 22:21381047-21381069 CTACAAAAAAAATTTTAGCTGGG - Intergenic
1181254525 22:21553776-21553798 CTACAAAAAAAATTTTAGCTGGG + Intronic
1182560125 22:31153130-31153152 CTACAAAAAAAAATTTAGCTGGG - Intergenic
1183905417 22:41036618-41036640 CTAAAAAAAAAGTTGTAGGTCGG - Intergenic
1184194586 22:42918367-42918389 CTTCTAGAAAATTTGTAGCTTGG - Intronic
1185353895 22:50354528-50354550 GAACACAAACATTTGTAGGTGGG + Intronic
950671492 3:14528973-14528995 TTTGAAAAACATTTGTGGCTGGG + Intronic
951027356 3:17844219-17844241 CTACAAATACAAAAGTAGCTGGG - Intronic
952102686 3:30033273-30033295 CTACAAAAACATTTTTTTCCAGG + Intergenic
952862690 3:37827419-37827441 CTACAAAAAAAATTTTAGCTGGG + Intergenic
956115993 3:65919396-65919418 CTACAAAAAAATTTTTAAATTGG + Intronic
957677488 3:83387845-83387867 CTTCCTCAACATTTGTAGCTTGG + Intergenic
959162060 3:102735862-102735884 CTACACAAACAATAGTGGCTGGG - Intergenic
959232768 3:103677349-103677371 CTGCAAAAACCTGTGTAACTTGG - Intergenic
962827553 3:139111090-139111112 CTACAAAAAAAATTCAAGCTGGG - Intronic
962836972 3:139198124-139198146 CAGCAATAAGATTTGTAGCTGGG + Intronic
962909486 3:139835146-139835168 TTAGAAAAACATGTGAAGCTTGG + Intergenic
965298673 3:166981846-166981868 CAACAAAAAAATATGTTGCTTGG + Intergenic
965659061 3:171021620-171021642 CTACAACAACATCTATAGATGGG + Intronic
965938001 3:174139021-174139043 CTACAAAATATTTTGTAACTGGG - Intronic
967166039 3:186780253-186780275 CTTAAAAAACATTTGTGGTTGGG - Intergenic
970136821 4:12934295-12934317 CTACAACAACATTTTGGGCTTGG + Intergenic
970833261 4:20368544-20368566 CTACAATTAAATTTGTTGCTGGG - Intronic
971868877 4:32209795-32209817 TTCCAAAATCCTTTGTAGCTGGG - Intergenic
972352472 4:38248761-38248783 CTACAAAAACAAAATTAGCTGGG + Intergenic
973901425 4:55476785-55476807 ATAGAAAAACATTTGTTACTAGG - Intronic
975451507 4:74532390-74532412 CTCCAAAAACATATGTCCCTTGG - Intergenic
978832448 4:113104748-113104770 CAACAAAAACATGTATAACTGGG + Intronic
979030423 4:115637139-115637161 CTACAAAAACATACGTATATAGG + Intergenic
979126151 4:116974740-116974762 ATATAAAAATACTTGTAGCTAGG - Intergenic
979342005 4:119535945-119535967 ATACAAACACCTGTGTAGCTAGG + Intronic
979416644 4:120449221-120449243 TTACAAAGACATTTTTAGCAGGG - Intergenic
979947078 4:126845620-126845642 CTAAAAAAATATTTTTAACTTGG - Intergenic
980063268 4:128155068-128155090 ATATAAAAAAATTTGTAGCCTGG - Intronic
980393360 4:132174780-132174802 CTACATGAACATTTGAAGGTAGG + Intergenic
981524554 4:145696874-145696896 ATACAAAAACAATATTAGCTGGG + Intronic
982250829 4:153404840-153404862 ATAGAAAAAAATTAGTAGCTGGG + Intronic
982750083 4:159150643-159150665 CAACAAACACATTTCCAGCTGGG - Intronic
983104465 4:163668878-163668900 CTCCAGAGGCATTTGTAGCTAGG + Intronic
983365118 4:166776456-166776478 CAACAAAAACATTTTCTGCTGGG + Intronic
983514874 4:168645230-168645252 TTACAACAACATTTAGAGCTGGG - Intronic
983760543 4:171400900-171400922 CTACAAGGACATATGAAGCTAGG + Intergenic
986869960 5:12034274-12034296 CTACAAACACAGTTGTATTTTGG - Intergenic
987636009 5:20542930-20542952 CCAATAAAACATTTGTAGCATGG + Intronic
989111309 5:37908776-37908798 CTACATAAATATCTGAAGCTGGG - Intergenic
990347681 5:54885505-54885527 AGACAAAAAGATTTGCAGCTTGG + Intergenic
990688711 5:58337834-58337856 CAACAAAAACACTGGTAGGTGGG + Intergenic
990735754 5:58859943-58859965 ATACAAATAGATTGGTAGCTGGG - Intergenic
991044063 5:62204742-62204764 CTACCAAAACTTTGGAAGCTCGG - Intergenic
993889318 5:93454453-93454475 CTCCTAAAACCTTTGCAGCTAGG + Intergenic
994080438 5:95703170-95703192 GTACAAAAACATTTGAAATTAGG + Intergenic
995408007 5:111823887-111823909 CTAAAAATACATCTGTATCTAGG - Intronic
996070384 5:119124345-119124367 CTAAAAAAGCATTTGTTCCTTGG - Intronic
996560857 5:124827490-124827512 ATACAAGAACATTTCTACCTTGG + Intergenic
996730037 5:126707950-126707972 CTAAAAAAAAATAAGTAGCTGGG + Intergenic
997725255 5:136114800-136114822 CTTAAAAAACATTTGTACGTTGG + Intergenic
998486865 5:142510503-142510525 CTATAAAGACATTTGTCACTGGG + Intergenic
998650639 5:144117766-144117788 CTACAAAATCCTGTGTTGCTAGG - Intergenic
999778230 5:154828012-154828034 CTACAAAAAATTTTTTAACTAGG - Intronic
1000883885 5:166728492-166728514 CCACAAAAACATCTGCATCTAGG - Intergenic
1003269570 6:4595514-4595536 GTACAAAAACAAAAGTAGCTGGG - Intergenic
1004445770 6:15696088-15696110 ATACAAAAAATTTTTTAGCTTGG + Intergenic
1007536924 6:42599889-42599911 TTAAAAAAACAATTCTAGCTAGG - Intronic
1007865394 6:44963702-44963724 TTACAAAAAAAGTTGCAGCTGGG + Intronic
1008110020 6:47481923-47481945 CTACAAAAAAATTTTAAACTAGG - Intronic
1008761904 6:54861836-54861858 CTAGAAAAAAACTTGTAACTTGG - Intronic
1008959245 6:57249148-57249170 CTCCAAAAACATTTGCATCTAGG + Intergenic
1010390248 6:75328781-75328803 TTAAAAAAACATTATTAGCTGGG - Intronic
1012739888 6:103003370-103003392 TGAAAAAAACAATTGTAGCTAGG + Intergenic
1013643224 6:112108570-112108592 CTGCAAAAAAATTTGTACATGGG - Intergenic
1015307232 6:131723146-131723168 CTACAAACACATTTGGAACTTGG - Intronic
1015397508 6:132751781-132751803 CTACAAAAATCTTTGTAGTCAGG + Intronic
1015571822 6:134629617-134629639 ATATAAAAACATTTATAGCAAGG + Intergenic
1016298233 6:142599510-142599532 CTACAAAAACATTTAAAAATTGG + Intergenic
1017582189 6:155878536-155878558 CTATAAAAACAATGTTAGCTGGG - Intergenic
1018344818 6:162889363-162889385 CTACCATAACATTTAAAGCTGGG - Intronic
1024905219 7:54371566-54371588 TTAAAAAAACATTCTTAGCTTGG - Intergenic
1026495342 7:70897022-70897044 CTACAAAAACAAAATTAGCTGGG - Intergenic
1028170923 7:87594813-87594835 CTATAAAAATAGTTGTAGGTAGG - Intronic
1028549035 7:92036445-92036467 CTACAAAAACATTTGTAGCTGGG - Intronic
1030358875 7:108574013-108574035 CTACAAAATCATTTTTAGGCTGG - Exonic
1031883167 7:127219597-127219619 CTACAAAAAAATAATTAGCTGGG - Intronic
1032202937 7:129835957-129835979 ATATAAAAACATTCTTAGCTAGG - Intronic
1032592137 7:133201258-133201280 TTAAAAAGACATTTGTAGCGAGG + Intergenic
1032816788 7:135483888-135483910 CTACAAAAAAACCTATAGCTAGG + Intronic
1036553547 8:9837314-9837336 ATACAAAAACATTTTTGGCCAGG + Intergenic
1038143739 8:24874443-24874465 CAACAAAAACATTAATAGGTGGG + Intergenic
1038156030 8:24991366-24991388 CTACCAAAATATTTTTAACTTGG - Intergenic
1039015029 8:33137567-33137589 CTACAACAACAATGGTAGATAGG + Intergenic
1039142146 8:34402277-34402299 CTCAAAAAATATTTGTAACTGGG + Intergenic
1040040806 8:42915215-42915237 CTACAAAAATATAATTAGCTGGG + Intronic
1041870595 8:62630297-62630319 CTATAAAAACATATGTAGGATGG + Intronic
1043273141 8:78359195-78359217 ATACCAAAACATTTGCACCTAGG - Intergenic
1044577444 8:93785907-93785929 CTACAAAAAAAAATTTAGCTTGG + Intronic
1044577878 8:93791177-93791199 ATAAAAATACATTTGTAGCTGGG - Intronic
1044588563 8:93891434-93891456 ATACAAAATCATTTGGATCTAGG - Intronic
1045008825 8:97939502-97939524 CTACAAAAAAATGTGTTGCCTGG - Intronic
1045580073 8:103468662-103468684 CTATAAAAATATTTCAAGCTGGG - Intergenic
1045980213 8:108176842-108176864 CTACAAAAACATTTATAATAAGG - Intergenic
1048983685 8:139717542-139717564 ATACAAAAAAATTAGTAGCTAGG + Intergenic
1049505299 8:142993138-142993160 AAAAAAAATCATTTGTAGCTGGG + Intergenic
1049991665 9:997450-997472 TTAAAAAAACACTTCTAGCTGGG + Intergenic
1050212356 9:3275201-3275223 CTACAAAAATATTTATATCTGGG - Intronic
1051113730 9:13670307-13670329 TTCCAAAAACATTTGTGCCTAGG - Intergenic
1053398493 9:37797559-37797581 CTACACACACATTTGTAGATTGG - Intronic
1053707775 9:40771728-40771750 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054417685 9:64892512-64892534 CTAAAAACACATTTGCAGCCAGG + Intergenic
1055230680 9:74061254-74061276 CTATAAACACTTTTGCAGCTGGG + Intergenic
1056089081 9:83186852-83186874 TTAAAAAAAAATTTCTAGCTGGG + Intergenic
1057165515 9:92922070-92922092 CTACAAAAAAAATATTAGCTGGG - Intergenic
1059751784 9:117254297-117254319 CTACACAAACATTTAGAACTGGG - Intronic
1060117590 9:120955341-120955363 CTAATAAAAAAATTGTAGCTTGG + Intronic
1060291276 9:122305113-122305135 TTAAAAAAACCTTTGTAGCTGGG + Intronic
1060613753 9:124992212-124992234 CCACAAAAGCATTTGTAGGCTGG - Intronic
1186255778 X:7717538-7717560 AAACAATAACATTTGTAGATAGG - Intergenic
1186524454 X:10235642-10235664 ATAGAAACCCATTTGTAGCTAGG - Exonic
1186654573 X:11598890-11598912 CTACAAAAACATTTTTAAAGTGG + Intronic
1187111947 X:16311358-16311380 GTACACATACGTTTGTAGCTAGG - Intergenic
1188242222 X:27807224-27807246 CTATAAAAACAAATGTAACTTGG + Intergenic
1189520356 X:41760616-41760638 GTACAGAAACAATAGTAGCTTGG - Intronic
1192431667 X:71116620-71116642 CAACAAAAAAATATTTAGCTGGG + Intergenic
1192492056 X:71584705-71584727 ATACAAAAACAAATTTAGCTGGG + Intronic
1193775102 X:85631544-85631566 CTACAAAAAGATTTGTATTTTGG - Intergenic
1195656155 X:107333307-107333329 CTAAAAAAACACTTGTAGGGAGG + Intergenic
1196207278 X:112955199-112955221 TTAAAAAAATATTTGAAGCTGGG - Intergenic
1198142753 X:133821725-133821747 CCAAAGAAACATTTGTTGCTTGG + Intronic
1198560028 X:137839535-137839557 CTATAAAAAAATCTGAAGCTGGG - Intergenic
1198653674 X:138890994-138891016 TTAAAAAAACATTTGTGGCCGGG + Intronic
1199565471 X:149211231-149211253 TTCCAAAAGCATTTGTAGCAGGG - Intergenic
1200241641 X:154498375-154498397 CTCAAAAAAAATCTGTAGCTGGG - Intergenic
1201785672 Y:17775567-17775589 CTACAAATACAAAAGTAGCTGGG - Intergenic
1201815881 Y:18130421-18130443 CTACAAATACAAAAGTAGCTGGG + Intergenic