ID: 1028553451

View in Genome Browser
Species Human (GRCh38)
Location 7:92097288-92097310
Sequence CTCGTTCTAGTTCTTGCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028553451_1028553452 25 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1028553451 7:92097288-92097310 CCAGAAGCAAGAACTAGAACGAG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1028553452 7:92097336-92097358 TCTGTATCAGAACCTTAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028553451 Original CRISPR CTCGTTCTAGTTCTTGCTTC TGG (reversed) Exonic
903104055 1:21059367-21059389 ATCATCCTAGTTCTTCCTTCAGG + Intronic
903561376 1:24230644-24230666 CTCTTTTTAGTTGTTTCTTCTGG - Intergenic
906943057 1:50272735-50272757 CTTGTTCTTCTTCTTGGTTCAGG - Intergenic
908064506 1:60388203-60388225 CTCGCTCCAGTACTTGCTGCAGG - Intergenic
909044155 1:70689126-70689148 CTCACTCTATTTCTTTCTTCAGG - Intergenic
909192134 1:72566856-72566878 CTCGCTCTGGTTCTTGCATATGG - Intergenic
909340215 1:74523468-74523490 CTCTTTCTTGTTGTTGCTTTTGG - Intronic
912592609 1:110840809-110840831 CTCTTTCTACTTCTAGCCTCTGG - Intergenic
915195665 1:154187735-154187757 CTTGTTCTTTTTCTTGCTCCTGG + Intronic
916756421 1:167774604-167774626 GTCTTTGTAGTTCTTGCTTCGGG + Intronic
920976670 1:210792200-210792222 CTCCTTCTACTTCTTTATTCAGG + Intronic
1066554158 10:36592932-36592954 CTCTCTCTAGTTCTTGCATGTGG - Intergenic
1067462053 10:46465458-46465480 CTGGTTCTAGTTTTTGTATCTGG - Intronic
1067625142 10:47919140-47919162 CTGGTTCTAGTTTTTGTATCTGG + Intergenic
1068026944 10:51657923-51657945 CACGTTCCATTTCTTTCTTCTGG - Intronic
1073463380 10:103679388-103679410 CTGGTACTAGGTCTTCCTTCTGG - Intronic
1075298651 10:121300408-121300430 CTCATGCAAGCTCTTGCTTCTGG - Intergenic
1077020423 11:414823-414845 CTGGTTCCAGTTCTTTCCTCCGG + Exonic
1078870795 11:15342741-15342763 CTCGGTCTAGTTTTTCTTTCAGG + Intergenic
1083837265 11:65279146-65279168 ATCGTTCAAGTTTTTGCTGCTGG - Intronic
1091403145 12:193062-193084 CTTGTTCTACTTCCTACTTCCGG - Intronic
1095786151 12:46110598-46110620 CTGGTGCTAGTACCTGCTTCTGG + Intergenic
1102979045 12:117227171-117227193 CTTGTTCTAGTTGCTGCTTTGGG + Intronic
1103645616 12:122389992-122390014 CTCATTCTCTTTCTCGCTTCTGG + Intronic
1103769432 12:123309571-123309593 CTTGTTCAAGATCTTGGTTCTGG - Exonic
1106225577 13:27783912-27783934 CTCCTTCTACATCTTGCTCCAGG - Intergenic
1107327649 13:39262393-39262415 CTAGTTCTGGTTCTAACTTCAGG - Intergenic
1107410786 13:40156861-40156883 CTTGTTCTAGCTCTTGCTTAGGG - Intergenic
1110298649 13:73899256-73899278 CTTGGTCTCGTTCTTGCTGCTGG - Intronic
1110485459 13:76036416-76036438 CTCCTTCTCGTTCTTACTCCTGG + Intergenic
1110542901 13:76726029-76726051 ATTGTTCAAGGTCTTGCTTCTGG - Intergenic
1116267805 14:42718009-42718031 TTCCCTCTGGTTCTTGCTTCTGG + Intergenic
1117998414 14:61500003-61500025 CTCGTTCTGGCTGTTTCTTCAGG + Intronic
1119376648 14:74199603-74199625 CACCTTCTAGTTCTGACTTCGGG + Exonic
1119679165 14:76578992-76579014 TTTGTTCTAGTTCTTCCTTGGGG - Intergenic
1126865490 15:52932582-52932604 TTCGTTCTTGTTCCTCCTTCAGG - Intergenic
1128394343 15:67208849-67208871 CGCTTTCTAGTTCTTCCTTGGGG - Intronic
1128651101 15:69414372-69414394 GAAGTTCTAGTTCTTGCTGCCGG + Exonic
1132386375 15:101403593-101403615 CACGTTCTTGTTCTTGCATTGGG - Intronic
1133090009 16:3396756-3396778 CTTGCTCTAGTTCTTGATGCCGG - Intronic
1134412852 16:14017400-14017422 CTTGTTCCAGTTTTTGCTGCAGG - Intergenic
1138503428 16:57463152-57463174 CTCCTTCCAGTCCTTGGTTCGGG + Intronic
1138799919 16:60014646-60014668 TTCTTTTTAGTTCTTGCTACAGG - Intergenic
1140211614 16:72975036-72975058 CTGGTGGTAGTTCTTGCTGCCGG - Intronic
1142907323 17:3052849-3052871 CTCTTTCTCATACTTGCTTCTGG + Intergenic
1142927241 17:3251392-3251414 CTCTTTCTCATACTTGCTTCTGG - Intergenic
1145170656 17:20653600-20653622 TTGGTTCTAGTTCTTGCTCATGG - Intergenic
1146262525 17:31431409-31431431 CTTGTTCTATTTCTTGTTCCAGG - Intronic
1149089088 17:52756412-52756434 CTAGTTTTATTGCTTGCTTCTGG - Intergenic
1150749989 17:67852384-67852406 CTTTTTATAGTACTTGCTTCTGG - Intronic
1153166459 18:2267183-2267205 CTCCTTCTTGTTCTGCCTTCTGG - Intergenic
1156857231 18:41796020-41796042 CTGGTCCTAGTTCTGTCTTCAGG + Intergenic
1158256789 18:55559876-55559898 CTGCTTCTTTTTCTTGCTTCAGG - Intronic
1159022664 18:63155988-63156010 CTTGTTCTTTTTCTTGCTTGAGG + Intronic
1161293824 19:3509403-3509425 CTCCGTCTGGTTCTTCCTTCAGG + Intronic
1166637909 19:44468136-44468158 CTTGATCTATTTGTTGCTTCTGG + Intergenic
928039582 2:27861457-27861479 CTAGTTACAGTTCTTGCTTGTGG - Intronic
930592675 2:53347843-53347865 CTCGTTTGAGTTCTTTATTCTGG + Intergenic
938244362 2:129765588-129765610 TTCTTGCTAGTTCTGGCTTCTGG - Intergenic
938996317 2:136682795-136682817 CTAGTCCTAAGTCTTGCTTCTGG - Intergenic
939803229 2:146738973-146738995 TTTGTTTTAGTTTTTGCTTCTGG + Intergenic
943206707 2:184907615-184907637 CTTGTTACAGTTCTTGTTTCTGG - Intronic
946389412 2:219406383-219406405 CTTGCTCAAGTCCTTGCTTCAGG - Intergenic
946651795 2:221899353-221899375 CTGGTTCTAGTTCTTTCCTAAGG - Intergenic
1168977547 20:1979246-1979268 CTCTTTCTAGCTGCTGCTTCTGG + Exonic
1173430301 20:42981967-42981989 CTCGGTCTAGTTGTGGCCTCTGG - Intronic
1179200428 21:39214057-39214079 CACCTTCTTGTTCTTACTTCAGG - Intronic
1179353979 21:40641523-40641545 CTGGTTCCAGTTCTTTCTTTTGG + Intronic
1180235000 21:46453280-46453302 CTCGAGCTAGTTCTTGCCTCAGG - Intergenic
1183519333 22:38287438-38287460 CTCATGCTAGTTCTTACCTCTGG + Intergenic
951384050 3:22023796-22023818 CTCTTCCAAGTTCTTGCTTTTGG - Intronic
954789504 3:53121141-53121163 CTAGTTCTAGTTCATATTTCTGG - Intronic
955364962 3:58303034-58303056 CTCATACTAGTTGTTGCTCCTGG + Intergenic
955571368 3:60310370-60310392 CTTGTTCTACTTCTTGCCCCAGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
961147660 3:124608590-124608612 CAGGTTCTAATTCTGGCTTCTGG + Intronic
964305517 3:155335468-155335490 CTGGTTCCAGTTGTTTCTTCTGG + Intergenic
972232745 4:37094294-37094316 GTCCTGCTAGTTCTTGTTTCAGG + Intergenic
972292819 4:37705734-37705756 CATGTTCTAGTTCTTGATCCAGG - Intergenic
973348631 4:49083702-49083724 TTCTTTCTAGTTTTTGCTACAGG - Intergenic
974740927 4:66006916-66006938 CCCCTTCTAATTCTTCCTTCAGG - Intergenic
975487847 4:74954032-74954054 CTACTTTTAGTTTTTGCTTCAGG - Intronic
976707026 4:88029774-88029796 CTCGTTTTCATTCTTGCTTCAGG - Intronic
978960003 4:114665319-114665341 CTCCTTCTTGTTCCAGCTTCTGG + Intronic
989967493 5:50482196-50482218 CATGTTCTAGATGTTGCTTCAGG - Intergenic
992172740 5:74120592-74120614 CTGGTTCTAGTTCTAGTTTGGGG + Intergenic
994257221 5:97613005-97613027 CTGGTTCTTGATCTTACTTCAGG - Intergenic
996050919 5:118932366-118932388 CTTTTTATAGTGCTTGCTTCAGG - Intronic
999976635 5:156918208-156918230 CACATCCTAGTTCTTGCTTGGGG - Intergenic
1002692271 5:181058898-181058920 CTGGTTCTAGTTCCTGCTGGTGG - Intronic
1003302675 6:4898514-4898536 CTCGTTTGATTTCTAGCTTCTGG - Intronic
1008247405 6:49194886-49194908 TTGTTTCCAGTTCTTGCTTCAGG + Intergenic
1010298007 6:74222953-74222975 CTCCATCCAGTTCGTGCTTCTGG + Intergenic
1010779851 6:79933053-79933075 ATTGTTTTATTTCTTGCTTCTGG - Intronic
1011001767 6:82597766-82597788 AACTTTCTAGTTCTTGATTCAGG + Intergenic
1015554794 6:134450209-134450231 CCCCTTCTAGTCCTTGCTTTGGG - Intergenic
1017151569 6:151285181-151285203 CTGTTTCCAGTTATTGCTTCTGG - Intronic
1017247988 6:152248161-152248183 GCAGTTCTAGATCTTGCTTCTGG - Intronic
1020011836 7:4809497-4809519 CACGTTCTTGTTCTTGTTTTGGG - Intronic
1021047223 7:15938603-15938625 CTAGTTCTAGTACTTGCTACTGG + Intergenic
1022031020 7:26491926-26491948 CGTGTTCTGGTTCCTGCTTCTGG + Intergenic
1023767355 7:43523734-43523756 CTCCCTCTGGTTCTTGCTTTCGG - Intronic
1024081796 7:45862592-45862614 TTCTTTCCAGTTCCTGCTTCAGG + Intergenic
1025933272 7:66013327-66013349 ATCATTTTAGTTTTTGCTTCAGG - Intergenic
1027642760 7:80757554-80757576 CTGGTTCTAGTTCAAGCTACAGG - Intronic
1028186293 7:87789802-87789824 GTCGTTCTTGCTCTTTCTTCAGG - Intronic
1028553451 7:92097288-92097310 CTCGTTCTAGTTCTTGCTTCTGG - Exonic
1030429455 7:109424945-109424967 CTTGTTCTTTTTCTTCCTTCTGG + Intergenic
1030744554 7:113149244-113149266 CTCCTTCTGGTTTTTTCTTCAGG + Intergenic
1031610110 7:123816225-123816247 CTAGTTCTAATTCTACCTTCTGG + Intergenic
1032628662 7:133622503-133622525 AGAGTTCTAGTTCTTGCTGCTGG + Intronic
1032989959 7:137382747-137382769 CTTGTTCTACTTCTTGCCTCTGG - Intronic
1033834206 7:145288891-145288913 CTAGTTCACGTTCTTGCTCCTGG - Intergenic
1034566166 7:151917461-151917483 CTCTTTTTACTTTTTGCTTCAGG + Intergenic
1035714438 8:1743345-1743367 CTGGTTCTCCTTCTTCCTTCGGG + Intergenic
1040133740 8:43828227-43828249 TTCTTTCTAGTTTTTGCCTCGGG - Intergenic
1041129023 8:54676679-54676701 CCAGTTCTAGTTCTTTCTTATGG + Intergenic
1046706603 8:117460426-117460448 CTTCTTCAATTTCTTGCTTCTGG + Intergenic
1047338835 8:123960638-123960660 CTCCTTCCAATTCTAGCTTCCGG + Intronic
1048392913 8:133985158-133985180 CTCTTTCTTGTTACTGCTTCTGG - Intergenic
1051424642 9:16920889-16920911 CTCGTTATAGTGCTGTCTTCAGG - Intergenic
1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG + Intergenic
1052533345 9:29716638-29716660 CTCTCTCTAGTCCTTGTTTCGGG + Intergenic
1052697148 9:31892211-31892233 CTCCTTGTAGTTCTTGGTTTTGG - Intergenic
1185715962 X:2342412-2342434 CTAGTTCTATTTCTAGCTCCTGG + Intronic
1186498875 X:10034779-10034801 CACCTTCTTTTTCTTGCTTCTGG - Intronic
1188193046 X:27196027-27196049 CTTGTCCTAGGTCCTGCTTCTGG - Intergenic
1189073196 X:37887039-37887061 CCTCATCTAGTTCTTGCTTCAGG + Intronic
1189430513 X:40942715-40942737 CTCATTCTCTTTCTTGCTTCTGG - Intergenic
1189587057 X:42472895-42472917 CTATTTTTAGTTCTTCCTTCTGG - Intergenic
1193279615 X:79630821-79630843 CTCTTTCACCTTCTTGCTTCAGG + Intergenic
1193731861 X:85111975-85111997 CTCAGTCTAATTCTTTCTTCTGG - Intergenic
1198023786 X:132684793-132684815 TTCTTTCTAGTTCTTTGTTCAGG + Intronic
1198746111 X:139892282-139892304 TTCCTTCTAGGCCTTGCTTCTGG - Intronic
1201620257 Y:15948971-15948993 GTCGTTCTACCACTTGCTTCTGG - Intergenic