ID: 1028557075

View in Genome Browser
Species Human (GRCh38)
Location 7:92135840-92135862
Sequence CCTTTTAAGCAGTTTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028557075_1028557083 13 Left 1028557075 7:92135840-92135862 CCCAACACAAACTGCTTAAAAGG 0: 1
1: 0
2: 5
3: 20
4: 232
Right 1028557083 7:92135876-92135898 TGTTCGGGGCTCAGACTTTCTGG 0: 9
1: 14
2: 16
3: 25
4: 98
1028557075_1028557078 -3 Left 1028557075 7:92135840-92135862 CCCAACACAAACTGCTTAAAAGG 0: 1
1: 0
2: 5
3: 20
4: 232
Right 1028557078 7:92135860-92135882 AGGTGATTGATCCCTTTGTTCGG 0: 2
1: 1
2: 1
3: 12
4: 128
1028557075_1028557079 -2 Left 1028557075 7:92135840-92135862 CCCAACACAAACTGCTTAAAAGG 0: 1
1: 0
2: 5
3: 20
4: 232
Right 1028557079 7:92135861-92135883 GGTGATTGATCCCTTTGTTCGGG No data
1028557075_1028557080 -1 Left 1028557075 7:92135840-92135862 CCCAACACAAACTGCTTAAAAGG 0: 1
1: 0
2: 5
3: 20
4: 232
Right 1028557080 7:92135862-92135884 GTGATTGATCCCTTTGTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028557075 Original CRISPR CCTTTTAAGCAGTTTGTGTT GGG (reversed) Intronic
903512675 1:23888090-23888112 CCCTTTAAGCATTTTGAGGTGGG - Intronic
906184004 1:43846578-43846600 CTTTTTAACCTGTTTGTGTCAGG + Intronic
906682875 1:47742635-47742657 TCTTTTGAGGAGTTTGTGTGAGG + Intergenic
908958233 1:69662590-69662612 TCTTTTAAGCAGTTTAGGTGTGG + Intronic
910979055 1:92940235-92940257 TGTTTTTAGCAGTCTGTGTTGGG - Intronic
912799284 1:112711140-112711162 CCTTCTAAGGGGTTTGTGTGAGG - Intronic
913175586 1:116270164-116270186 CCTTTAAGTCAGTTTGAGTTAGG - Intergenic
913354662 1:117906194-117906216 CCTTCTAAGCACTGCGTGTTTGG - Intronic
913566206 1:120074936-120074958 TCTTTTAAGCATTTTATGCTAGG + Intergenic
913631925 1:120718618-120718640 TCTTTTAAGCATTTTATGCTAGG - Intergenic
914286794 1:146234292-146234314 TCTTTTAAGCATTTTATGCTAGG + Intergenic
914435255 1:147653930-147653952 CCCAATATGCAGTTTGTGTTTGG - Intronic
914547825 1:148685032-148685054 TCTTTTAAGCATTTTATGCTAGG + Intergenic
914618685 1:149385316-149385338 TCTTTTAAGCATTTTATGCTAGG - Intergenic
914973292 1:152331547-152331569 CCTGGCAAGCAGTTGGTGTTGGG + Intergenic
915198691 1:154210024-154210046 CCTTCTAAGCAGTTTTTACTAGG + Intronic
917256303 1:173120256-173120278 GCTATAAAGCAGTTTGTTTTGGG - Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
918753362 1:188302924-188302946 CCATTTATTCAGTTTGTCTTTGG - Intergenic
920404681 1:205700469-205700491 CCTTTCAAGTCTTTTGTGTTTGG - Intergenic
922424276 1:225479129-225479151 CCTTTTAAACAGTCAGTCTTTGG + Intergenic
1063206705 10:3838842-3838864 CCACTAAAGCAGGTTGTGTTAGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065230778 10:23596234-23596256 CATTTAAAGCAGTATGTGGTGGG - Intergenic
1066395220 10:35014014-35014036 AATCTTAAGCAGTTTATGTTTGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1068037131 10:51774890-51774912 CCTTTTAAGACATTTGTGTTTGG + Intronic
1071474178 10:86010973-86010995 CCTTTAAAGGAGTTTGGGATAGG + Intronic
1071985770 10:91048759-91048781 CCTTTAAAGCACTTTTTTTTTGG + Intergenic
1072392777 10:95005462-95005484 CCTTTTCAACAAATTGTGTTGGG - Intergenic
1073624641 10:105084603-105084625 GCTTCTCAGCAGTTTGTGTTAGG + Intronic
1074227661 10:111502678-111502700 CATTTTTAGCAGTTTGATTTTGG + Intergenic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1077759336 11:5074575-5074597 GCTTTTAATCAGTGTGTGGTGGG - Intergenic
1078964818 11:16326715-16326737 TGTTTTAAGCACTTTGTTTTTGG - Intronic
1082637213 11:55611025-55611047 TCTTTAAATCAGTTTGTTTTAGG + Intergenic
1083193578 11:61069551-61069573 CCTTCTAAGCTGTGTGTCTTTGG - Intergenic
1084056970 11:66640579-66640601 CCCTTTAAAGAGTTTGTGTAAGG - Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1085558626 11:77449262-77449284 CTTTTTAAGCTGTTTCTGTGTGG - Intronic
1085620821 11:78036930-78036952 CATTTTACACAGTTTGTCTTAGG + Intronic
1086069090 11:82779926-82779948 CCTTTTAATGTGTTTTTGTTTGG - Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1090027095 11:123177250-123177272 CCTTTGATGCAGTGTGTATTTGG + Intronic
1091572230 12:1697282-1697304 CCTTTTCAGTGTTTTGTGTTTGG + Intronic
1091745665 12:2991359-2991381 TCTTTTAAGTAGTTTGTTTCAGG + Intronic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1092847655 12:12598838-12598860 ACTTTTAAAGAGTTTTTGTTCGG + Intergenic
1094224816 12:28033196-28033218 CCTTCTAAGCAGCTGGTGTGGGG - Intergenic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1095342872 12:41112865-41112887 CCTTTTAAGGAGTTGCTGTAAGG + Intergenic
1098922275 12:76313403-76313425 GCCTTTCAGCAGTTTGTGCTGGG - Intergenic
1101008800 12:100428717-100428739 CGTTTTAATAAATTTGTGTTGGG + Intergenic
1103693289 12:122793347-122793369 TCTTTTCAGTGGTTTGTGTTAGG - Intronic
1106093308 13:26619189-26619211 ACTTATAAGCAGGTTGTGTATGG - Intronic
1106123295 13:26879985-26880007 CCTCTTAAGCTATTTGTTTTAGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107645427 13:42489891-42489913 ACTTTTAAATAGTTTGTGTGGGG - Intergenic
1108236146 13:48407761-48407783 CTTTTTAAAAAGTTTGTTTTTGG + Intronic
1108950776 13:56089040-56089062 CCTTTTTAGCTTTTTGTTTTTGG + Intergenic
1109401779 13:61840635-61840657 CATTTGAAACAGTCTGTGTTAGG - Intergenic
1109496640 13:63180456-63180478 CATTCTAAGCAGATTGTTTTAGG + Intergenic
1109584745 13:64384931-64384953 ACTTTTAAACAGTATTTGTTAGG - Intergenic
1109896003 13:68691132-68691154 CCTTTTAACAGGTTTTTGTTTGG - Intergenic
1112858094 13:103795691-103795713 ACTTTTAATCAGTTTGGGTTTGG - Intergenic
1113410529 13:110083751-110083773 CCTCTGAAACAGTTTGTGTAAGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114301923 14:21385926-21385948 CCTTTTATGCCATTTGTGATGGG - Exonic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1118864148 14:69689565-69689587 TCTATTAAGCACTATGTGTTAGG - Intronic
1119820192 14:77609176-77609198 CCTTTTAAGAAGTCTGTCCTGGG + Intronic
1120939246 14:89930957-89930979 GCTTAAAAGCAGTTTTTGTTAGG - Intronic
1121370033 14:93347947-93347969 TTTTTTAAGCACTTTTTGTTAGG + Intronic
1121450128 14:94001702-94001724 ACTTTGAGGCAGTTTGTGTTTGG - Intergenic
1122327441 14:100891084-100891106 CCTCATAAGGAGTTTGGGTTGGG + Intergenic
1122395926 14:101430625-101430647 TCTTTTCAACAGTTTGTGCTGGG - Intergenic
1202945428 14_KI270726v1_random:21508-21530 CATTTTCAGAAGATTGTGTTTGG + Intergenic
1123674567 15:22696552-22696574 TCTATTAAGCAGATAGTGTTGGG - Intergenic
1124326582 15:28769543-28769565 TCTATTAAGCAGATAGTGTTGGG - Intergenic
1124352256 15:28964997-28965019 CCTTTTATGGATATTGTGTTTGG + Intronic
1125001360 15:34773667-34773689 TATTTTTAGCAGATTGTGTTTGG - Intergenic
1127209233 15:56755500-56755522 CCTTTTAATCAATGTCTGTTTGG - Intronic
1127366816 15:58299159-58299181 GCTTTTAAGAAATTTGTCTTTGG + Intronic
1127686243 15:61348302-61348324 CCATTTAAACAGGATGTGTTTGG - Intergenic
1127925391 15:63535305-63535327 CCTTCTAAGCAATTGTTGTTTGG + Intronic
1128121243 15:65148691-65148713 CCTTTTACACAGTTTTTTTTAGG - Exonic
1129751364 15:78066985-78067007 ACCTTTAACCATTTTGTGTTGGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1134365592 16:13574934-13574956 CCTTTCTAGAAGTTTGAGTTGGG - Intergenic
1134382664 16:13742569-13742591 CTTAATGAGCAGTTTGTGTTGGG - Intergenic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1135451973 16:22566217-22566239 TTGTTCAAGCAGTTTGTGTTGGG - Intergenic
1138841859 16:60519103-60519125 CCTTTTAATAGTTTTGTGTTTGG - Intergenic
1139667392 16:68467211-68467233 CCTTTCAAGAAGTTTGTGAGGGG - Intergenic
1139762619 16:69198471-69198493 CTCTTTAAGGAGTTTGTGTGTGG + Intronic
1141205093 16:81927379-81927401 TGTTTTAATCAGGTTGTGTTGGG + Intronic
1145013822 17:19384344-19384366 CCTTGTAAGGAGTTGGTGCTCGG + Exonic
1147119274 17:38326303-38326325 CTTTTCATGCAGTTTGTCTTTGG + Exonic
1149324422 17:55515560-55515582 CCTTATAAGCAGGCTGTGTGAGG + Intergenic
1150566841 17:66349573-66349595 CCTTTTGAACAGTTTGGGTATGG + Intronic
1152741087 17:82018656-82018678 GCTTTGAAGCAGTTTGACTTTGG + Intergenic
1153205394 18:2694063-2694085 ACTTTTAAGCACTATGTGTTTGG + Intronic
1156578689 18:38350069-38350091 ACTTTGAAGCAGTTTGTAATTGG - Intergenic
1156767034 18:40669471-40669493 CTTTTTATGAAGTTTATGTTTGG - Intergenic
1156954033 18:42939471-42939493 CCTTTTAATCACCTTTTGTTAGG + Intronic
1159213364 18:65359032-65359054 CCTATTAAGCAATTTGTGTAGGG - Intergenic
1160444261 18:78914857-78914879 ACTCTTAAGCAGAATGTGTTGGG - Intergenic
1160984330 19:1831141-1831163 CCTCTTGGGCAGTTGGTGTTGGG - Intronic
1162255395 19:9485026-9485048 CCTTTTTAGTATTTAGTGTTTGG - Intronic
1164003529 19:21129125-21129147 CCCTTTAAGCATTTTGAGGTGGG - Intergenic
1164142372 19:22484250-22484272 ACTTTTAAGCGTTTTGTGGTGGG + Intronic
1165603873 19:37082061-37082083 TCTTTTAACCTGTTTGTGTTTGG + Intronic
1166809846 19:45508424-45508446 CCAGTTAAGCAGATTGTGTGCGG - Intronic
1168441263 19:56369155-56369177 TCTTTTAAGCACTGTGTGGTGGG + Intergenic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926388716 2:12364924-12364946 CCTTTTATGCTGTTTAGGTTTGG - Intergenic
926422109 2:12710077-12710099 TCTTTTAAGGAGTTGTTGTTTGG + Intergenic
929437282 2:41938455-41938477 CCTTTCAAGTCGTTTGTGTGAGG - Exonic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
932642941 2:73468322-73468344 TCATTGAAGCAGTTTGTGCTAGG - Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
937733996 2:125267178-125267200 ACTTTTTAGCAGGATGTGTTTGG + Intergenic
938617898 2:133018733-133018755 GCTTTTATGCAGTTTGCTTTTGG + Intronic
941823187 2:169863345-169863367 CCTTTTAGGCAATTTGTTATCGG + Intronic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
941834018 2:169996515-169996537 CCTGTTAGACAGTTTGGGTTAGG + Intronic
944494828 2:200296072-200296094 CATTTGAAGCAGACTGTGTTTGG - Intergenic
944692189 2:202168457-202168479 CTTTTTGAGCACTTTGTGATGGG - Intronic
945071125 2:205989996-205990018 ATTTTTGGGCAGTTTGTGTTGGG - Intergenic
945338000 2:208615733-208615755 CCTTTTAACCATTTTGAGGTGGG + Intronic
946542456 2:220699542-220699564 GCTAATAAGCAGTTTGTGCTGGG - Intergenic
946966167 2:225040864-225040886 TCTTTTGAACAGTTTGTCTTTGG + Intronic
947348080 2:229214111-229214133 CCTTCTAAGTAGTGTTTGTTAGG + Intronic
948196574 2:236101230-236101252 CCTTTTAATCTGCTTGTGGTGGG - Intronic
948335760 2:237205854-237205876 CCTTTTCAGCACTGTGGGTTTGG - Intergenic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1170905493 20:20512436-20512458 TCTTTTTATCAGTTTGTGGTTGG - Intronic
1170964723 20:21056822-21056844 CATTTTGAACAGTGTGTGTTCGG + Intergenic
1172055907 20:32154091-32154113 CCTTCTAGGCAGTTTGGGTTGGG + Intronic
1172866095 20:38098700-38098722 ACTTTTAAGAAAATTGTGTTTGG - Intronic
1173404905 20:42756301-42756323 CCGTTTGGGGAGTTTGTGTTGGG + Intronic
1174977841 20:55354560-55354582 CCTTTTTTGCATTTTGTGTTAGG + Intergenic
1175240806 20:57547188-57547210 TCATTAAAGCAGTGTGTGTTTGG + Intergenic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1179408328 21:41143215-41143237 CCTTTGAAGCACTTGGTGCTCGG + Intergenic
1179514357 21:41896658-41896680 CCTGCTAAGGAGTTTGTATTCGG - Intronic
952366300 3:32677802-32677824 CCTTTTAAGGAGTTTGGACTTGG + Intergenic
957156107 3:76546875-76546897 CCTTTTCAGTAGTTTGAATTTGG - Intronic
957933204 3:86909736-86909758 CCTTTGAAGCTTTTTTTGTTAGG - Intergenic
958102283 3:89028099-89028121 CCTTTTAAGAAGATTGTTCTGGG + Intergenic
960843928 3:121989125-121989147 CCTTTTGAGCAGTATATTTTAGG - Intronic
961906233 3:130265409-130265431 CATTGTTAGCAGTTTGTCTTGGG + Intergenic
963196889 3:142542441-142542463 CCTTTTAGTCACTTTGGGTTGGG + Intronic
963434293 3:145248550-145248572 CATTTTTAGTAGTATGTGTTTGG + Intergenic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
965591369 3:170363024-170363046 CATTTTAAACACTTAGTGTTAGG - Intronic
967566882 3:190983687-190983709 GATTTTAAGCAATTTGTTTTGGG - Intergenic
967700435 3:192586098-192586120 CTTTTTATTCAGTTTGTGTATGG - Intronic
969659371 4:8517652-8517674 CCTTTCAAGAAGTCTGTCTTTGG + Intergenic
969911020 4:10446401-10446423 CCTTCTATACAGTTTGTGATGGG + Exonic
971412303 4:26386954-26386976 CGTTTTTAGCAGTTTATTTTTGG + Intronic
972009665 4:34161152-34161174 CTTTTTATACAGTTTTTGTTAGG - Intergenic
972765167 4:42146154-42146176 TCTTTAAAGCAGTTTGAGTGGGG - Intronic
974132638 4:57775621-57775643 CCTTTTAAGAAGGTTTTTTTTGG + Intergenic
975400986 4:73939398-73939420 CCCTTGGAGCACTTTGTGTTTGG + Intergenic
976192358 4:82500046-82500068 CCTTTGAAGAAATTTGTCTTAGG + Intronic
977474319 4:97485951-97485973 CCTTTTCAACAAATTGTGTTGGG + Intronic
978789027 4:112641409-112641431 CCTTTGGAGGAGTTTGTGTAAGG + Intronic
979735901 4:124083458-124083480 ACTTTCCAGAAGTTTGTGTTTGG - Intergenic
980161254 4:129165981-129166003 CCTTTTGAGTATTTTGAGTTGGG + Intergenic
980566156 4:134545700-134545722 CATTTCAACCAGTTAGTGTTAGG - Intergenic
981306681 4:143254127-143254149 CCTTGTAAGCAGTTTGCCTGCGG + Intergenic
981550099 4:145935452-145935474 TTTTTAAAGCAGTTTGTGTTTGG - Intronic
984108726 4:175582174-175582196 CCTTTTCAGTAGCTTTTGTTGGG + Intergenic
986126136 5:4883856-4883878 CATTTTGAGCAGTTTTTATTTGG - Intergenic
987152186 5:15054438-15054460 TCTTTTAGGCAGTATATGTTGGG + Intergenic
987868783 5:23583458-23583480 CTGTATAAGCAATTTGTGTTAGG - Intergenic
993315310 5:86396381-86396403 CCTTTTATGCAATTTCTTTTTGG - Intergenic
995659303 5:114463143-114463165 CCTTTTCCACAGTATGTGTTAGG - Exonic
996192866 5:120567024-120567046 GTTTTTCAGCAGTTTGTCTTGGG + Intronic
996446547 5:123559811-123559833 ACTTTTAAACAGTTTGATTTTGG + Intronic
996470005 5:123849203-123849225 CCTTCTAATAATTTTGTGTTTGG + Intergenic
998292947 5:140934202-140934224 TCTTTTAAACATTTTGTGTGAGG - Intronic
998959986 5:147475553-147475575 CATTTTGAGCAATTTGTTTTAGG - Intronic
1003878368 6:10458251-10458273 CTTTTTAAGATGTGTGTGTTAGG - Intergenic
1006411190 6:33874589-33874611 CCTTGTAAGCAGATTCTGTCAGG + Intergenic
1007326851 6:41068758-41068780 GCTTTTAAGTTGTTTGTCTTTGG + Intronic
1007868067 6:44996605-44996627 ACTTTTAAGAAGTTTCTTTTAGG - Intronic
1007923958 6:45635961-45635983 CCTTCTAAGGGGTCTGTGTTGGG + Intronic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1011952745 6:92987284-92987306 CATTTTCTGCAGTTTGTGTAAGG + Intergenic
1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG + Intergenic
1013612225 6:111806169-111806191 CTTTTTAACCAGCTTGTGTTCGG + Intronic
1013758480 6:113488294-113488316 CCTTTTAATCAGCATGGGTTAGG - Intergenic
1013978796 6:116105533-116105555 CCTTTTGTGCACTTTTTGTTTGG + Intronic
1014510220 6:122311460-122311482 CTTTTTATATAGTTTGTGTTGGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018849643 6:167577835-167577857 CCTTTCGTGCAGTTGGTGTTGGG + Intergenic
1020591383 7:10142386-10142408 TATTTTAACCAGTTTGTGATGGG - Intergenic
1020933815 7:14434217-14434239 CCTATTAAACCCTTTGTGTTAGG + Intronic
1021695688 7:23273705-23273727 GCTTTTAAACATTTTGTGTAGGG + Intronic
1023223505 7:37945211-37945233 CCTTTGAAAAAGTTTGGGTTTGG - Intronic
1023287185 7:38631734-38631756 CTTTTAATGCAGTTTGTATTTGG + Intergenic
1024994769 7:55264846-55264868 CTTTTTAGACAGTTTGTGATTGG - Intergenic
1026333219 7:69371426-69371448 TCTTTTAAAGAGATTGTGTTTGG - Intergenic
1026920899 7:74154630-74154652 CATTTTAAGGATTTTGTGATGGG - Intergenic
1027991466 7:85368385-85368407 ACTTTTAAGCTTTTTGTATTTGG + Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1028657724 7:93229820-93229842 CCTTTTAAAAAGTGTTTGTTAGG + Intergenic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1031313157 7:120224920-120224942 CTATGAAAGCAGTTTGTGTTGGG - Intergenic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1033926395 7:146466484-146466506 CCTTTCTATCAGTTTGTATTAGG - Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038962281 8:32535147-32535169 TCTCTTAAGGAGTTTCTGTTTGG + Intronic
1039555806 8:38474063-38474085 CCTTTTCTGCAGCTGGTGTTGGG - Intergenic
1041308810 8:56493010-56493032 CCTGTTTATCAGTTTGGGTTAGG - Intergenic
1042083023 8:65076835-65076857 CCTTTGAAGCAGATTCTTTTCGG + Intergenic
1042446016 8:68885924-68885946 TCTTTTAAGTAATTTGTTTTGGG - Intergenic
1043373547 8:79621641-79621663 CCCTTAAAGCAGATTGAGTTGGG - Intronic
1043981538 8:86646727-86646749 CCCTTTAAGAAGGTTGTTTTTGG + Intronic
1046186745 8:110731792-110731814 CCTTTTAAGAAGTTTGGGATGGG - Intergenic
1047732257 8:127737188-127737210 CCTTTTAAGAAGTTGGCATTTGG + Intronic
1049129478 8:140825126-140825148 CATTTAAAGCATTTGGTGTTTGG - Intronic
1049307496 8:141912670-141912692 CCTTTTAAGATTTTTGTTTTAGG - Intergenic
1051157346 9:14164796-14164818 TCTTGAAAGCAGTTTATGTTTGG + Intronic
1055002805 9:71472524-71472546 CTTTTTAAGCATTTTGAGGTGGG + Intergenic
1055183024 9:73413050-73413072 ACTGTTAATCAGTTTGTGTGTGG - Intergenic
1055884540 9:81045185-81045207 CCTTTTCAGCAAGTGGTGTTAGG + Intergenic
1057174575 9:92986703-92986725 CTTTTGAAGCAGTTTGTCTGCGG - Intronic
1061052838 9:128206193-128206215 CCTGTGAAGCATTTTCTGTTGGG - Intronic
1185619507 X:1444821-1444843 CCTTCCAAGCAATTTGTGTGAGG + Intronic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186953937 X:14659436-14659458 GATTTAAAGCAATTTGTGTTGGG + Intronic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1191117393 X:56866052-56866074 CCATTTCTGCAGTTTGTGTCTGG - Intergenic
1191121420 X:56909987-56910009 CATTTAAAGCAGTTTGTAGTGGG - Intergenic
1191746397 X:64493742-64493764 TCTTTTAATAATTTTGTGTTTGG - Intergenic
1192288824 X:69769421-69769443 CCTGTTAAGCAGTATGTTGTTGG + Intronic
1192816270 X:74596124-74596146 GCTTTTCAGGAGTTTTTGTTAGG - Intronic
1193868128 X:86762100-86762122 CTTTTAAAGGACTTTGTGTTTGG + Intronic
1194437072 X:93879907-93879929 GCTTTTAAGCAATTTGATTTTGG - Intergenic
1194489780 X:94531369-94531391 CCTTTGATGGAGTTTTTGTTGGG - Intergenic
1195380834 X:104269326-104269348 CCTTTTAAGAAGTTCAAGTTAGG - Intergenic
1195861351 X:109386667-109386689 CCTTTTAAGTACTTTGTGCTTGG - Intronic
1196052369 X:111319127-111319149 CCTGTTAAGAAGTTTGCATTTGG + Intronic
1196692730 X:118577620-118577642 CCTTATAAGCTGTTTGACTTGGG + Intronic
1198366360 X:135944037-135944059 CCTTTTAAAAAATTTGTGTAGGG - Intergenic
1199350275 X:146792316-146792338 CTTTTTAAGAATTTTGGGTTTGG - Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201646956 Y:16244472-16244494 TTTTTTAAGTAGTTTGGGTTTGG - Intergenic
1201655855 Y:16340830-16340852 TTTTTTAAGTAGTTTGGGTTTGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic