ID: 1028563396

View in Genome Browser
Species Human (GRCh38)
Location 7:92200854-92200876
Sequence TAAAGGACATTCATGACATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028563393_1028563396 27 Left 1028563393 7:92200804-92200826 CCTACAAAGTAAAACATGTCAAT 0: 1
1: 0
2: 4
3: 17
4: 342
Right 1028563396 7:92200854-92200876 TAAAGGACATTCATGACATTGGG 0: 1
1: 0
2: 1
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028563396 Original CRISPR TAAAGGACATTCATGACATT GGG Intronic
901337688 1:8465339-8465361 TAAAGGACATTGATTACAAGCGG - Intronic
902972620 1:20065077-20065099 TTCAGGACATTTATGACAATAGG + Intronic
904726441 1:32551954-32551976 TAAAACACATTGATGACATTTGG + Intronic
905802466 1:40853977-40853999 CAAACTACATACATGACATTTGG - Intergenic
907861779 1:58360970-58360992 CAAAGGAATTTCATGACATGGGG - Intronic
908161979 1:61419029-61419051 TAAATGACAGTCATAAAATTTGG + Intronic
908350446 1:63281794-63281816 TCAGGGACATTCATAACTTTTGG - Intergenic
909014478 1:70368044-70368066 AGACGGACATGCATGACATTTGG + Intronic
909710250 1:78641429-78641451 TTATGGACATTCATGACCTGTGG - Exonic
913215734 1:116618782-116618804 TTAACTACATTCATAACATTAGG + Intronic
915695213 1:157734023-157734045 TTAAGAACATTCATGACTTGTGG + Intergenic
915866700 1:159508493-159508515 AAAAAGACTTTCATGAAATTCGG + Intergenic
921614661 1:217252132-217252154 TAAAGAAAAATCATGACAGTGGG + Intergenic
922349862 1:224726502-224726524 TAAAGGACATTAATGATAACCGG - Intronic
922588799 1:226756761-226756783 TTAAGGACATTCATGATTTATGG + Intergenic
923487864 1:234453161-234453183 TAAAGGTCATAGTTGACATTAGG - Intronic
923610871 1:235492487-235492509 TAAACTATATTCATTACATTTGG + Intronic
923886024 1:238157170-238157192 TAAAGAACTTTCCTGACACTGGG + Intergenic
924198033 1:241629641-241629663 TAAAGGAACTTCATGGCAATTGG - Exonic
924898521 1:248369494-248369516 TACAGGAAATTCATAACTTTTGG + Intergenic
1063884837 10:10566932-10566954 CAAAGAACATGCATGGCATTTGG + Intergenic
1066502105 10:36004072-36004094 TGAAGGACATGCATGTCAGTGGG + Intergenic
1067411956 10:46072532-46072554 TAAAATCCATTAATGACATTTGG - Intergenic
1068913682 10:62405894-62405916 TAAAGTACATTCCTGAGAATGGG - Intronic
1070240816 10:74678496-74678518 TGAAGGCCATTCAGGATATTAGG - Intronic
1070597994 10:77846291-77846313 TGAAGGACAGTCCTGACATCTGG + Intronic
1071417286 10:85453110-85453132 TTAAGGAGATTCCTGACCTTGGG - Intergenic
1073394331 10:103205857-103205879 ACACGGACATGCATGACATTTGG + Intergenic
1073665537 10:105529021-105529043 TACACCACATTCAGGACATTGGG + Intergenic
1074423379 10:113329091-113329113 TAAATGACATTCCTGACAACTGG - Intergenic
1078184775 11:9042307-9042329 TAAGGGACATTCATGCCATGGGG - Intronic
1078269178 11:9778628-9778650 CAAAGGGCAGTGATGACATTAGG + Intergenic
1078751351 11:14167205-14167227 TAAAGTCCAGTAATGACATTTGG - Intronic
1079771134 11:24461236-24461258 TAGAGGACATTCTTGGCAGTGGG + Intergenic
1088171677 11:107004825-107004847 TAGAGGACATTTCTGACATGAGG + Intronic
1088296548 11:108302926-108302948 TAAGTGAAAATCATGACATTTGG + Exonic
1089320853 11:117625855-117625877 TAGGGGACATTGATGGCATTTGG - Intronic
1089807699 11:121106232-121106254 GAAATAACATTCATGGCATTGGG - Intronic
1090687240 11:129135876-129135898 TAAAGTACCTTCATGACATTGGG + Intronic
1092511294 12:9159555-9159577 TAAAGGGCTATCATGACAGTTGG + Intronic
1092612850 12:10189743-10189765 CAAAGGATATTCATAAAATTTGG + Intronic
1092802484 12:12184210-12184232 TCAAGCACCTGCATGACATTTGG - Intronic
1093276993 12:17141011-17141033 TCAAGGACATTGATCTCATTGGG + Intergenic
1099332854 12:81312490-81312512 TAAAGGACATTCTTTACCTCAGG + Intronic
1099928873 12:89050924-89050946 TCAATGACATTATTGACATTGGG - Intergenic
1100614731 12:96222194-96222216 TTGAGGACTTTCATGACAATAGG - Intronic
1101407333 12:104440368-104440390 AAAAGGTCATTCATCAGATTTGG + Intergenic
1101407623 12:104442487-104442509 AAAAGGTCATTCATCAGATTTGG - Intergenic
1103064943 12:117889693-117889715 TAAAGCAAGTTCCTGACATTTGG - Intronic
1105615335 13:22006708-22006730 TAAAGGACATTCTAGATATTTGG + Intergenic
1106843451 13:33711237-33711259 AAAAGGACATCAATGACATTGGG + Intergenic
1108232388 13:48361130-48361152 TAAAGGAAATTTATAAAATTTGG - Intronic
1108801358 13:54099932-54099954 TGTAGGAAATTCAAGACATTTGG - Intergenic
1109733778 13:66453535-66453557 TAAAGGTTATTCATTACAATAGG - Intronic
1110153620 13:72285927-72285949 TAATGGATATTCATAACATGTGG - Intergenic
1111308748 13:86452453-86452475 TAAAATACATGCATGAGATTTGG - Intergenic
1111611269 13:90611063-90611085 CAAAGGACATTCATGTATTTTGG + Intergenic
1116169985 14:41388059-41388081 TAAAAGTCATTTATGAAATTAGG - Intergenic
1116607671 14:47022731-47022753 TTAAGGATATTCATGACATAGGG + Intronic
1117173916 14:53129157-53129179 AAATGGACGTGCATGACATTTGG + Intronic
1118082159 14:62373053-62373075 GAAAGGACAGTCAAGATATTGGG - Intergenic
1119586963 14:75845015-75845037 GAAAGGACATTCCGGGCATTAGG - Intronic
1120085014 14:80262491-80262513 TAAAAGACATTTATTACACTAGG - Intronic
1120616785 14:86716137-86716159 TAGAGGACACTCACGACATGTGG + Intergenic
1121224557 14:92311806-92311828 CAAAGGACACTCATGACCTAGGG + Intergenic
1123929904 15:25161594-25161616 TAAAGAATATTCCTCACATTAGG + Intergenic
1124207351 15:27732801-27732823 AAAAGCCCATTCATGACTTTTGG + Intergenic
1124875214 15:33585593-33585615 TAAAGGTCATTCAAGTAATTTGG - Intronic
1125698286 15:41657730-41657752 TAAAGAACATTCATAAAATAAGG - Intronic
1127072436 15:55299739-55299761 TAAAGGACATTAATGGGACTTGG + Intronic
1127687961 15:61366939-61366961 TAAAGGCCATTAATAACAGTGGG + Intergenic
1127714830 15:61639928-61639950 TAATGGACATTCATTAAAATGGG + Intergenic
1129095932 15:73208002-73208024 TCAAGGAGATTCAGGATATTTGG + Intronic
1129132002 15:73507925-73507947 TAAAAGCCATTCATGACCCTAGG - Intronic
1131396026 15:92087014-92087036 TAAAGTACCTTCATGATGTTGGG - Intronic
1134421380 16:14093447-14093469 TAAAGAACTTTCATTAAATTTGG + Intronic
1138846318 16:60571622-60571644 TGAAGGACATTGAAGAGATTAGG + Intergenic
1144941430 17:18944615-18944637 CAAAGCACATACATTACATTAGG - Intergenic
1146449121 17:32958114-32958136 TTAAGTACATTCACGTCATTGGG + Intergenic
1149763744 17:59257016-59257038 TAAAGGACATTTATAAAATAAGG - Intronic
1150346611 17:64409668-64409690 TAAAGCACGTCCTTGACATTTGG - Intronic
1151256024 17:72877310-72877332 TCAAGAACATTCATGACACTGGG + Intronic
1156601293 18:38610259-38610281 TTAACTACTTTCATGACATTAGG + Intergenic
1156819813 18:41358868-41358890 AAAATGACATTCTTTACATTTGG + Intergenic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1159694955 18:71545413-71545435 TCAAGGACATTCATGACTTATGG - Intergenic
1159840678 18:73395039-73395061 TGAAGGACTCTTATGACATTGGG + Intergenic
1161212225 19:3073182-3073204 AACTGAACATTCATGACATTAGG + Intergenic
1164127684 19:22333502-22333524 GACAAGAGATTCATGACATTTGG + Intergenic
1164232619 19:23303535-23303557 TAGAGGACGTTCAGGACATTTGG - Intergenic
926522296 2:13930120-13930142 TAATGGAAATTAATGATATTTGG + Intergenic
926576957 2:14593222-14593244 TCAAGCACATTTTTGACATTGGG + Intergenic
926610266 2:14939832-14939854 TAAAAGTCATTCTTAACATTTGG - Intergenic
929736559 2:44556006-44556028 TAAAGGAAAATCAAGACATGGGG + Intronic
930151470 2:48064513-48064535 TAAACAACATACAAGACATTTGG + Intergenic
930855814 2:56017030-56017052 TAAAGGACATTTATAAAATAAGG - Intergenic
931027031 2:58122222-58122244 TAAAGGAGACTCATAACATTAGG + Intronic
932064645 2:68541201-68541223 TAGAATATATTCATGACATTGGG + Intronic
933716234 2:85363005-85363027 TCAAGGACATTCAGTACAGTGGG + Intronic
935059206 2:99593369-99593391 TAAAGGACAGTGATGAGATCAGG - Exonic
935871660 2:107457422-107457444 TTAAGAACATTCATGACTTACGG - Intergenic
936794528 2:116189293-116189315 AAAAGGACACGCATGAAATTTGG - Intergenic
938177541 2:129148544-129148566 TGAAGGACAGTCATGAAAGTGGG + Intergenic
939112971 2:138030045-138030067 TAAAGGACATTCAGGAAAAGAGG - Intergenic
940540734 2:155012729-155012751 TGAAGGAGAATAATGACATTGGG + Intergenic
940689796 2:156901622-156901644 AAAAGGACATGCTTGAAATTGGG + Intergenic
944572518 2:201058920-201058942 TAAATGACATCCACCACATTAGG - Intronic
945423304 2:209665637-209665659 TAAAGGGCATTGGTGACATTTGG - Intronic
1170754853 20:19192323-19192345 TAAATGACATTAATGATATGAGG - Intergenic
1172424777 20:34848288-34848310 TAAAGGACATTCTGGACAGGAGG - Intronic
1175250500 20:57607249-57607271 TCAAAGTCATTCATGAAATTTGG - Intronic
1177577750 21:22980776-22980798 TAGAGGACAATCATCAAATTAGG + Intergenic
1178085227 21:29105507-29105529 TAAAGGACATTCAAGAGCTATGG + Intronic
1181011221 22:20041764-20041786 TAACAGACATTCATAAAATTGGG - Intronic
1182707314 22:32293167-32293189 TAAAAGACATTTACAACATTAGG - Intergenic
1184395659 22:44236559-44236581 TAAAAGACATTTACAACATTAGG - Intergenic
949178360 3:1094978-1095000 TAAATAACAATCATGAAATTTGG + Intronic
955115068 3:55989982-55990004 TAAATGACCTTCCTGAGATTGGG - Intronic
955553977 3:60116160-60116182 ACAAAGACATTCCTGACATTAGG + Intronic
957515689 3:81247898-81247920 TAAATGACAGTCAGCACATTAGG - Intergenic
957859140 3:85921667-85921689 TAAAGTACATCCTTTACATTAGG + Intronic
958110822 3:89142115-89142137 TAAAATATACTCATGACATTTGG + Intronic
958271950 3:91511476-91511498 TAAAGGAACTTCACGGCATTTGG + Intergenic
958878192 3:99639018-99639040 TAAAGTACATTTTTGACAATGGG - Intronic
959316224 3:104810650-104810672 CAAAGGACATGCATCATATTGGG - Intergenic
963550705 3:146718757-146718779 TAAAGGACATTCAAAATATAAGG - Intergenic
966008336 3:175045260-175045282 AAAAGGACATTCATGTCTTCGGG - Intronic
967913975 3:194564452-194564474 TAAAGGACATTCAGGATAAAAGG + Intergenic
969280724 4:6169195-6169217 GGAAGGACATGCATGAGATTGGG - Intronic
970870128 4:20807151-20807173 TTTATGACATTTATGACATTTGG + Intronic
973659969 4:53094640-53094662 TTAAAGAAATTGATGACATTGGG - Intronic
975959450 4:79884074-79884096 TAAAGGACCTCCAGGCCATTAGG + Intergenic
979003258 4:115254988-115255010 TAATTCTCATTCATGACATTTGG + Intergenic
979222492 4:118244743-118244765 TAAACAACAATCTTGACATTGGG - Intronic
981933870 4:150218428-150218450 TGAAGGACACTCATCACATCAGG - Intronic
982271151 4:153590136-153590158 TAAAGGCCATGCATTGCATTTGG + Intronic
983086790 4:163455583-163455605 TAAAGGGCATAGGTGACATTTGG + Intergenic
983852360 4:172597121-172597143 TTAAGGACATTAATTACATCTGG - Intronic
986343666 5:6814608-6814630 ACAATGACATACATGACATTAGG - Intergenic
987446343 5:18024204-18024226 AAAAGGAAATACTTGACATTAGG - Intergenic
990060738 5:51644440-51644462 TAAAAGAGAGTAATGACATTTGG + Intergenic
990130083 5:52570672-52570694 TAAAATACCTTCATGACCTTTGG - Intergenic
993201525 5:84822254-84822276 TAAAGGTCACACATGACGTTAGG - Intergenic
994520926 5:100834024-100834046 TAAAGGATATTGAAGAGATTAGG + Intronic
995620444 5:114020458-114020480 TAAGGGACATTTAGGACATCTGG - Intergenic
997550821 5:134751622-134751644 AAAAGGACATTTATGCTATTGGG - Exonic
998950378 5:147387965-147387987 TAAGGGACATTCCTCACAATAGG - Intergenic
999965268 5:156802681-156802703 CAAAGGACATTCCTGACTTGGGG - Intergenic
1000006078 5:157186226-157186248 TAAAGGACAGTCCTGAAAATTGG + Intronic
1000417785 5:161001618-161001640 TAAACGAAATACATCACATTAGG - Intergenic
1005294508 6:24412082-24412104 AAAAGAACATTCATAAAATTTGG - Intronic
1009171218 6:60402527-60402549 TAAAGGAACTTCACGGCATTTGG - Intergenic
1009733792 6:67647676-67647698 TTAAAGTCATTCATGAGATTTGG - Intergenic
1009819030 6:68775529-68775551 TAAAGGACAAGCATGAGATTTGG - Intronic
1010120515 6:72370385-72370407 CAAAGGGCATTCATGACTGTGGG - Intronic
1014147706 6:118017114-118017136 TAGAGTCCATTCAAGACATTGGG - Intronic
1014195272 6:118550222-118550244 TAAAGGAAAATGATCACATTTGG + Intronic
1014873778 6:126630152-126630174 TTATGGACATTCATGATATGTGG + Intergenic
1014985525 6:128002306-128002328 TAAATAACAAACATGACATTTGG + Intronic
1015043134 6:128745716-128745738 TAAAAGATATTCAAGACATTTGG - Intergenic
1015363725 6:132373099-132373121 GAAAAGACAATAATGACATTTGG + Intronic
1020834306 7:13129598-13129620 TAAAGAACATTTTTAACATTAGG + Intergenic
1024347013 7:48323518-48323540 TAAATGAAATTAATGACCTTGGG - Intronic
1024882525 7:54105438-54105460 TAAAGGAGATTCTAGACACTTGG - Intergenic
1024923161 7:54582443-54582465 TAAAGGCCATGCTTTACATTAGG - Intergenic
1025741218 7:64197905-64197927 TAAAGGACAAAAATGACATTTGG + Intronic
1025741451 7:64200372-64200394 TAAAGTACAAAAATGACATTTGG - Intronic
1027439282 7:78200884-78200906 TAAAGTATTTTCATTACATTAGG + Intronic
1028563396 7:92200854-92200876 TAAAGGACATTCATGACATTGGG + Intronic
1028696623 7:93720808-93720830 GAAAGGACATTCATGCCTTGTGG + Intronic
1032897450 7:136266941-136266963 TAATGGAAATAAATGACATTAGG - Intergenic
1033889178 7:145987337-145987359 TAAAGGAGAGTAATGACACTAGG - Intergenic
1035421788 7:158735698-158735720 TAAAAAACAAACATGACATTTGG - Intronic
1035555896 8:566828-566850 TAGATGACATTCATTGCATTTGG + Intergenic
1037179623 8:15989935-15989957 TAAAGAACTTCCATGAGATTGGG + Intergenic
1037565114 8:20111476-20111498 TAAAGGAACTTGATTACATTTGG - Intergenic
1039240053 8:35546308-35546330 TAAAGGACATTTATTAAAATGGG + Intronic
1040786736 8:51175578-51175600 TACATGTCATTTATGACATTCGG + Intergenic
1040937849 8:52799732-52799754 TAAGGGACCTGCATGTCATTAGG - Intergenic
1041298047 8:56381364-56381386 TAAAGTTGATTCATGTCATTTGG + Intergenic
1041862814 8:62533543-62533565 TAAAGAACATGAATTACATTTGG + Intronic
1042190627 8:66182824-66182846 TGAAGGACATTCATGCTATTAGG - Intergenic
1042361245 8:67885579-67885601 AACAGGACATTCATGACATAGGG - Intergenic
1045691897 8:104767864-104767886 CCAAGGACATTTAGGACATTTGG - Intronic
1046169238 8:110483685-110483707 TAAAGAACATTAATGTGATTTGG - Intergenic
1046907719 8:119591944-119591966 TAAAGGAGATTGCTCACATTTGG - Intronic
1046927575 8:119808506-119808528 TTAAGGACATTCATGATTTAGGG - Intronic
1047469758 8:125158605-125158627 TAAGGAACATTCATATCATTTGG - Intronic
1048191900 8:132297564-132297586 TAGAGTACATTTATGACATAGGG - Intronic
1048564760 8:135583882-135583904 CAAGAGACATTCAAGACATTTGG + Intronic
1048903628 8:139065248-139065270 AAAAGGAAAATGATGACATTTGG + Intergenic
1052473969 9:28934401-28934423 TAAAGGAGATTCATAAAAGTTGG - Intergenic
1052574173 9:30270172-30270194 TAAAGGACATAAATAAAATTTGG + Intergenic
1053261089 9:36665212-36665234 AAAAGGATATTATTGACATTAGG - Intronic
1058223605 9:102333170-102333192 TTAAGAACATTCATGATAATAGG - Intergenic
1059221388 9:112623753-112623775 TAAAGGACTCTCTTGAAATTGGG - Intronic
1060459789 9:123839962-123839984 TAAAGAACATTTATAATATTTGG - Intronic
1062190315 9:135244632-135244654 AAAATGACATGCATCACATTTGG + Intergenic
1186040796 X:5475701-5475723 TTAAGTATATTCATGTCATTTGG - Intergenic
1187012271 X:15292100-15292122 TAAAGGACTTACATGATGTTTGG + Intronic
1187298995 X:18029951-18029973 TTATGGACTTTTATGACATTGGG + Intergenic
1188151022 X:26675411-26675433 AAAAGGGCACTCATGTCATTAGG + Intergenic
1190368296 X:49718159-49718181 TAATGGACATTGGGGACATTGGG + Intergenic
1190976469 X:55407151-55407173 GTAAGGAAATGCATGACATTAGG - Intergenic
1192994853 X:76502332-76502354 TAAAGGACAATCAAGAGCTTGGG + Intergenic
1194009399 X:88539942-88539964 TAATGGACAATAATAACATTAGG + Intergenic
1194933137 X:99913723-99913745 TAAAGGACATCCATGGAAGTAGG + Intergenic
1195300715 X:103527549-103527571 CAAAGGCCATTCAAGTCATTCGG - Intergenic
1195791503 X:108592646-108592668 AAAAGGACAGACCTGACATTTGG - Intronic
1196273898 X:113743688-113743710 AAAAGGACATTCAAGAAAATTGG + Intergenic
1196661028 X:118268891-118268913 CAAAGTACATTAATTACATTAGG - Intergenic
1197056983 X:122133779-122133801 ATAAGGACATACATGAGATTGGG - Intergenic
1197151347 X:123223211-123223233 TCAAGGACATTCTTGACAAAGGG - Intronic
1197699793 X:129590572-129590594 CTAAGGACAATCATGACAATTGG - Exonic
1197954887 X:131935513-131935535 TAAAAGGCATTCATTCCATTGGG - Intergenic
1198699879 X:139384900-139384922 GAAAACACCTTCATGACATTGGG + Intergenic
1199331684 X:146567933-146567955 TCAAGGACCTTAATGACACTAGG - Intergenic
1199719968 X:150536438-150536460 TTTAGGACATTCACAACATTGGG - Intergenic
1200473799 Y:3620294-3620316 TAAAGAACATTCATGATTTATGG + Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200889198 Y:8305020-8305042 TAAAGGAAATTGCTGACAGTGGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic