ID: 1028563521

View in Genome Browser
Species Human (GRCh38)
Location 7:92202604-92202626
Sequence TGCCAGAAAGATAATGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028563518_1028563521 0 Left 1028563518 7:92202581-92202603 CCACAAATACTAAACTAAGAATG 0: 1
1: 0
2: 1
3: 14
4: 284
Right 1028563521 7:92202604-92202626 TGCCAGAAAGATAATGGGTTAGG 0: 1
1: 0
2: 1
3: 17
4: 176
1028563517_1028563521 19 Left 1028563517 7:92202562-92202584 CCAATTCTTATAATATTGACCAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1028563521 7:92202604-92202626 TGCCAGAAAGATAATGGGTTAGG 0: 1
1: 0
2: 1
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028563521 Original CRISPR TGCCAGAAAGATAATGGGTT AGG Intronic
902322492 1:15678178-15678200 TTCTAGGAAGATAATGGGTGAGG - Intergenic
904596613 1:31650298-31650320 AGACAGAAGGATAATGGGGTTGG + Intergenic
908152192 1:61313410-61313432 AGCAAGAAAGAGAAGGGGTTGGG + Intronic
908723015 1:67146595-67146617 TGCCTAAAAGATAATGGGCCAGG - Intronic
910749452 1:90613077-90613099 TGGAAAAAAGAGAATGGGTTGGG - Intergenic
911976153 1:104498008-104498030 TCCCAGGAAGATAATGGGAGTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912847517 1:113088531-113088553 TGCCAGGAAGATTTAGGGTTGGG + Intronic
917241793 1:172956651-172956673 TAAGAGAAAGATAATGGTTTGGG + Intergenic
918514427 1:185346843-185346865 GGCCAGAAAGAAAATGTTTTAGG + Intergenic
918627252 1:186670342-186670364 TGCCATAAGGAGAATGGTTTGGG + Intergenic
919833374 1:201557298-201557320 TGGAAGAAAGACAAAGGGTTGGG + Intergenic
920111612 1:203591182-203591204 TGACAGAAAGAAAGTGGGCTTGG + Intergenic
920650332 1:207832783-207832805 TTCCAAAAAAATAATGTGTTTGG + Intergenic
921728868 1:218554411-218554433 TGCAAGAGAGAAAATGGGATAGG - Intergenic
923247403 1:232145793-232145815 TTCAAGAAAGATGATGGGGTGGG + Intergenic
1068810212 10:61247132-61247154 ACCCAGAAAGAGAATGGTTTGGG - Intergenic
1070253579 10:74794903-74794925 TGTCAGAAAAATAATTGGGTAGG + Intergenic
1071733262 10:88270043-88270065 TGTCAGAAATATGAAGGGTTTGG - Intergenic
1073096726 10:100984466-100984488 TGGGAGAAAGAGAAAGGGTTTGG - Exonic
1074585809 10:114767544-114767566 CTCCAGAAAGAAAATGGGTGGGG + Intergenic
1075197516 10:120373775-120373797 TGCCAGAATGATTAATGGTTTGG + Intergenic
1077732505 11:4747499-4747521 AGTCAGAAAGAGAGTGGGTTTGG + Intronic
1078611677 11:12825114-12825136 TTCAAGAAAGATAATAGCTTGGG + Intronic
1079031784 11:16991649-16991671 GGCCAGAGAGGTAATGGGGTTGG + Intronic
1083047462 11:59749624-59749646 TGCCAGAAAGATAAGGAGAAGGG + Intronic
1084646514 11:70462002-70462024 TGCCAGGAACAAAATGGGGTGGG - Intergenic
1084853001 11:71959147-71959169 TGACAGAAAGAGAATAGGATTGG - Intronic
1085799384 11:79574736-79574758 TAGCAGAAAGAGCATGGGTTTGG + Intergenic
1086777407 11:90856303-90856325 TGACAGAAAGATAAAGTGTATGG - Intergenic
1087713141 11:101577660-101577682 TGCCAGATAGATAATGCTTGGGG + Intronic
1088145830 11:106676316-106676338 TCCCTGAAAAATAATGGCTTTGG + Intronic
1088146670 11:106688994-106689016 TAAGAAAAAGATAATGGGTTTGG - Intronic
1091493843 12:955411-955433 TGTTAGCAAGATAATGGGTTGGG - Intronic
1094043039 12:26137381-26137403 TGCCAGAAAGAGCATGGCTTTGG + Intronic
1095669481 12:44841830-44841852 TCCCAGAAAGATCATGCCTTAGG + Intronic
1096440935 12:51643830-51643852 TGACAGACAGATAATGACTTAGG + Intronic
1097367411 12:58732375-58732397 TGAGAGAAAGATAATGGGAGTGG - Intronic
1097841713 12:64327998-64328020 TGCCAAAAAAAAAATGGCTTAGG - Intronic
1098906719 12:76170112-76170134 TGCCAGAAGCACAATGGGTCAGG - Intergenic
1102464314 12:113119599-113119621 TGACAGGAAGATACTGGGTTTGG - Intronic
1109585405 13:64395651-64395673 GGCAAGCAAGATAATGGGTGGGG + Intergenic
1112847371 13:103660585-103660607 TGCCAGAAAAATATTGGTATTGG - Intergenic
1115368570 14:32586110-32586132 TGCATGAAAGAAAATGGATTTGG + Intronic
1117286677 14:54292044-54292066 TGCCAGGGAGAAATTGGGTTTGG - Intergenic
1117656886 14:57964603-57964625 TCCCAGGAAAATAATAGGTTAGG - Intronic
1125114455 15:36073058-36073080 TGCCAAAAAGATTCTGGTTTAGG - Intergenic
1125218161 15:37302872-37302894 TGACAGAAATATATTGGTTTTGG + Intergenic
1125824911 15:42668025-42668047 TGCAAGAATGCTAATGAGTTTGG - Intronic
1126700508 15:51362517-51362539 TGTCAGAAAGATGATTGGGTTGG + Intronic
1126837675 15:52683820-52683842 TGTCAGGAAGATACAGGGTTTGG - Intronic
1127722127 15:61713227-61713249 TGCCAGAAAGCTCATGGAATGGG - Intergenic
1127749886 15:62025569-62025591 AACCAGAAAGATAATTGGTCAGG - Intronic
1127792878 15:62413935-62413957 TGCCAGATAAATAAAGGGCTTGG - Intronic
1129954802 15:79626407-79626429 TGCCAGAAAGCTTAAGAGTTAGG + Intergenic
1131773101 15:95762403-95762425 TGGAAGACAGATAATGAGTTTGG - Intergenic
1131841716 15:96444336-96444358 AGTCAGAAACATAATGGCTTTGG - Intergenic
1136021722 16:27444783-27444805 TGCCAGAAAGCTCAGGGCTTAGG - Intronic
1139211558 16:65082834-65082856 TACCAGGAAGGTAATGGTTTGGG - Intronic
1139912014 16:70403333-70403355 AGACAGAAAATTAATGGGTTTGG + Intronic
1140191735 16:72823312-72823334 TACCAGAAAGATACAGAGTTAGG + Intronic
1141104637 16:81223390-81223412 TGCCAGACAGAGAATGGGAAAGG + Intergenic
1141121754 16:81364225-81364247 AGACAGAAAGAAAATAGGTTGGG - Intronic
1141547003 16:84776812-84776834 TCTCAAAAAAATAATGGGTTAGG - Intronic
1142867774 17:2801147-2801169 TGATAGGAAGATAATGGGTCTGG - Intronic
1144111517 17:12039333-12039355 TGCCAAAAAGAAAGTGGGGTGGG - Intronic
1146755385 17:35427347-35427369 TGTCAGAAAAATAGTGGATTAGG - Intronic
1146839370 17:36139617-36139639 TCCTGGAAAGATAATGGGGTGGG + Intergenic
1146965427 17:37024661-37024683 TTTCAGAAAGATAATTGGCTGGG + Intronic
1147753334 17:42750973-42750995 TGCCAGAAAGAGAACGTGTTTGG + Intergenic
1149060621 17:52417199-52417221 TGCCAGTAAGACAATTGGTTTGG - Intergenic
1149525532 17:57352623-57352645 TGGAAGAAAGATAAAGGGTAGGG + Intronic
1149711615 17:58747781-58747803 TTCCAGAAAGAAAATGATTTGGG - Intergenic
1150974464 17:70068426-70068448 TGGTAGAAAGATAAGAGGTTAGG - Intronic
1151109638 17:71660949-71660971 TGCCAAAAAGAAAATGTGTTTGG + Intergenic
1152616285 17:81339435-81339457 TCCCAGGATGATGATGGGTTAGG + Intergenic
1153259495 18:3209554-3209576 TGTCAGAAAGGTGATGGGTTGGG - Intronic
1157551002 18:48581964-48581986 ACCCAGAAGGATGATGGGTTTGG + Intronic
1159100263 18:63949954-63949976 TGCCAGAAAGCAAAAGTGTTGGG + Intronic
1159818889 18:73114448-73114470 TGCCAGAAACATAACTGGTTAGG + Intergenic
1166351654 19:42201702-42201724 AGCCAGAAAGAGGAAGGGTTTGG - Intronic
1167822771 19:51944190-51944212 TGCCATAAACATAATGCATTTGG + Exonic
926652097 2:15357864-15357886 TGCCAGCAAGATAGTGGTGTGGG - Intronic
927023882 2:19045849-19045871 TGCTAGAAAGAGCATGGGCTGGG - Intergenic
929825280 2:45305252-45305274 TGCCTGCAAGATAAGGGGGTGGG + Intergenic
930491210 2:52075072-52075094 TGACAGAAACATAGTGTGTTGGG - Intergenic
930840573 2:55840835-55840857 GGGGAGAAAGATAATGGGTTTGG - Intergenic
938681591 2:133697225-133697247 AGCCAAGAAGATAATTGGTTTGG + Intergenic
939479008 2:142725545-142725567 TGCCATGAAGTTAATGGGATGGG - Intergenic
941454343 2:165697353-165697375 AGCAAGGAAGATAATGGATTAGG + Intergenic
942532647 2:176928328-176928350 TAGCAGAAAGAAAATAGGTTTGG - Intergenic
945389751 2:209249812-209249834 ACCCAGAAAGATTATAGGTTAGG + Intergenic
1170896885 20:20423023-20423045 TGCCTGAGAGATAATGGGGCAGG + Intronic
1170996679 20:21367305-21367327 TGCCATAATGTTAATGAGTTAGG + Intronic
1171107662 20:22450340-22450362 TGCCAGAAACAGACTGGGCTTGG + Intergenic
1172787195 20:37476488-37476510 GGCCAGAAAGGAAAAGGGTTGGG - Intergenic
1181078866 22:20400851-20400873 TGCCAGATATATCATGGGGTGGG + Intronic
1183845023 22:40535943-40535965 TGCCAGTGAGATAGTGGGTGTGG - Intronic
1184515243 22:44957791-44957813 TCTCAGAAAGATACTGGGTGAGG - Intronic
950532256 3:13558945-13558967 TGAGAGAAAGATAAGGGGTTGGG + Intronic
950742839 3:15063838-15063860 TGCCAGGCAGATAATGGGAAGGG - Intronic
950840465 3:15963835-15963857 TGACAGTAAGATAATGAGGTGGG + Intergenic
951772124 3:26270352-26270374 TTCCAGAAAGAATAAGGGTTTGG + Intergenic
953620601 3:44529348-44529370 GGCCAGAAATATAAGGGATTTGG - Intergenic
957120327 3:76082285-76082307 TAGCAGAAAGTTAATGGATTGGG + Intronic
957755209 3:84476536-84476558 TGTCAGCAAGATAATGGATCAGG + Intergenic
959122941 3:102254443-102254465 CTGAAGAAAGATAATGGGTTGGG + Intronic
959250847 3:103942662-103942684 TCCAAGAAAGATAATACGTTAGG - Intergenic
959847559 3:111052247-111052269 TGCCACGAAGAGAATGGATTTGG - Intergenic
959947228 3:112138243-112138265 TGCCAGAAAGTGACTGGGCTTGG - Intergenic
963366139 3:144336894-144336916 TTTCAGGAAGATCATGGGTTAGG + Intergenic
964793855 3:160477269-160477291 TGCCAGAATGCTAATTGATTGGG - Intronic
971467447 4:26978621-26978643 TGCCAGAAAGTAACTGGCTTAGG + Intronic
972195702 4:36651265-36651287 TGGTAGAAAGATAGTGGCTTTGG + Intergenic
973583417 4:52367496-52367518 TGCCAGAAAGGGATTGGGTTTGG + Intergenic
974606690 4:64160742-64160764 AGCAAGAAAGAGAATGGGTGGGG - Intergenic
975857795 4:78642878-78642900 GGTTAGAAAGATAATGAGTTTGG - Intergenic
976399707 4:84593913-84593935 TTCCAGGAAGATAAGGGGTGAGG + Intronic
976866920 4:89739507-89739529 ATCAAGAAAGATAATGGGCTAGG + Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
977449255 4:97174368-97174390 TGCCAGTAAGATGAAGGATTTGG + Intergenic
979380749 4:120003903-120003925 TGCCAGATAGATTAGGGGTTGGG - Intergenic
980888436 4:138788214-138788236 TGCCTGAAAGATACTGTGTTAGG - Intergenic
980907082 4:138958698-138958720 TGCCAGAAAGGAAATGGGGTTGG + Intergenic
981616681 4:146650187-146650209 TGCCAGAAAGACACCGTGTTGGG - Intergenic
982295846 4:153828226-153828248 TGAAAGAAATATAATGGGTGGGG - Intergenic
984663068 4:182394890-182394912 GGCCAGAAAGATAAATTGTTTGG + Intronic
985701630 5:1377008-1377030 GGCCAGAAAGACACTGGGATGGG - Intergenic
987899454 5:23992240-23992262 TGAAAGAAAGATAATGTGATTGG + Intronic
988431568 5:31124949-31124971 TTCCAAAAAGATAATCGGCTAGG + Intergenic
991042678 5:62192215-62192237 TGCAAGAAAGAGAATGGGTTGGG - Intergenic
991249473 5:64543992-64544014 TGCCAAAAAGATGATGCTTTAGG + Intronic
995598890 5:113775228-113775250 GGTCAGAAACATACTGGGTTGGG + Intergenic
997621782 5:135303824-135303846 TAGCAGAAAGATCATGGGTTTGG - Intronic
998413338 5:141927757-141927779 AGGCAAAAAGATAATGGGGTAGG - Intronic
999514328 5:152285830-152285852 TGCCTGAAAGACAATGGGCCAGG + Intergenic
999537538 5:152533776-152533798 TGCCAGACATTTAATGGGTGTGG + Intergenic
1000821443 5:165989588-165989610 TACCTGAGAGATACTGGGTTTGG - Intergenic
1004999871 6:21229967-21229989 TGCCAGATAGAGAACAGGTTGGG - Intronic
1006734871 6:36266442-36266464 TGTCAGGAAGAAAATGGGATGGG + Intronic
1007139034 6:39553249-39553271 GGCCAGAAAGTTCATGGTTTTGG + Intronic
1007412872 6:41674922-41674944 TGCCAGCAAGATAAAAGGGTGGG + Intergenic
1009304882 6:62076110-62076132 TGACAGAAATATATGGGGTTGGG - Intronic
1010028377 6:71245749-71245771 AGCCAGAAGGAGGATGGGTTGGG + Intergenic
1010947861 6:81999190-81999212 TGTCAGCAAGATGATGGATTAGG + Intergenic
1013493267 6:110671603-110671625 AGCTAGAAAGAGAAGGGGTTTGG + Intronic
1015190099 6:130463158-130463180 TGTCAGAATTATAATGAGTTAGG - Intergenic
1016092542 6:139997426-139997448 TGCCATCAAGATTATGGGATGGG + Intergenic
1018463108 6:164017796-164017818 AGACACAAAGATACTGGGTTTGG - Intergenic
1019417030 7:932538-932560 TGTCAGAAAGATGATGGGACGGG - Intronic
1020504313 7:8964355-8964377 TGATAGAAAGAAAATGAGTTGGG + Intergenic
1024550167 7:50556108-50556130 AACCAGAAAGAGAAAGGGTTTGG + Intronic
1025088880 7:56046044-56046066 TGCCTCAAAGATGGTGGGTTTGG + Intronic
1025900989 7:65744657-65744679 TGCCTCAAAGATGGTGGGTTTGG + Intergenic
1028563521 7:92202604-92202626 TGCCAGAAAGATAATGGGTTAGG + Intronic
1028859732 7:95635313-95635335 TGCAATAAAGATAAATGGTTTGG - Intergenic
1029913813 7:104184971-104184993 TTACAGAAAGAAAATGGGCTTGG - Intronic
1030780069 7:113589749-113589771 TCACAGAAAGATAATGGGGAGGG - Intergenic
1032938149 7:136757702-136757724 TGCTAGAAAAATAATTGGGTGGG - Intergenic
1033056347 7:138058439-138058461 TGTCAGACAGATAAAGGCTTTGG - Intronic
1034058788 7:148067080-148067102 TGCCAGAAAAATAATTCGGTAGG - Intronic
1035836676 8:2761824-2761846 TTCCAGAAAGATACTGAGATGGG + Intergenic
1036011918 8:4735360-4735382 TGAGAGAAAGACAATGGGCTTGG - Intronic
1037896311 8:22658729-22658751 TAGCAGAAAGATAAGGGGTGGGG - Intronic
1039662575 8:39483114-39483136 TGGCTGAAAGATACTGGATTTGG - Intergenic
1039672104 8:39612917-39612939 TACCAGAAAAATAATGGGGGAGG - Intronic
1039812437 8:41061542-41061564 TGCCAGAAAGAATCTGGGATTGG + Intergenic
1040584879 8:48729537-48729559 TGCTAGAAAAATAAGAGGTTAGG + Intronic
1041584369 8:59498772-59498794 TGGAAGAAAGATTATGAGTTTGG - Intergenic
1042414880 8:68508005-68508027 TGCCAGAAAGATAAGGCCTTAGG - Intronic
1043431918 8:80203700-80203722 TGCCAGACAGTAAATGGTTTGGG - Intronic
1046017380 8:108621280-108621302 TCCAAGAAAGTGAATGGGTTGGG + Intronic
1048040048 8:130718387-130718409 TGCAATAAAGATAAAGAGTTGGG + Intergenic
1048718961 8:137300316-137300338 TGCCAGCAATATTATGGTTTAGG + Intergenic
1049028976 8:140018844-140018866 TGCCAGAAAAATAATGAATACGG + Intronic
1050649134 9:7756236-7756258 TGCCAGCAAGACAAAGGCTTGGG - Intergenic
1052590457 9:30486904-30486926 TGAGAGAGAGATAATGGATTGGG + Intergenic
1054843553 9:69768969-69768991 TTACAGAAAGATAATGGCTGGGG + Intergenic
1055668341 9:78574470-78574492 TGCCTGAAAGAAAATGCCTTTGG - Intergenic
1057722462 9:97544083-97544105 GGACAGACAGATAATGGGCTTGG - Intronic
1057739336 9:97698028-97698050 TGCCAGGTAGACAGTGGGTTTGG + Intergenic
1061398635 9:130356611-130356633 TGCCTGAAAGATAAGGAGCTAGG - Intronic
1186587514 X:10891250-10891272 GGCCAGAAAGAAAATGTTTTAGG + Intergenic
1189427727 X:40916485-40916507 TGCCAAAAGGCTAATGGGGTAGG - Intergenic
1189629304 X:42934568-42934590 TGCCAGAAGGATTAGGGGCTGGG + Intergenic
1189741103 X:44117841-44117863 TGGCATGAAGAGAATGGGTTTGG - Intergenic
1189889069 X:45580048-45580070 TACAAGAAAGATAAAGGGGTAGG - Intergenic
1190970526 X:55343188-55343210 TGGCAGAAAGAAATTGTGTTGGG - Intergenic
1191839522 X:65501769-65501791 TGCCTGAAAAATAATGCCTTGGG - Exonic
1194533076 X:95074631-95074653 TGTTAGAAAGAAAATGGTTTAGG + Intergenic
1194802147 X:98287275-98287297 TGCCTGAAAGATGACGGGCTGGG - Intergenic
1194874017 X:99164196-99164218 GGCCACAAAGATAAGGGGTCAGG + Intergenic
1194959867 X:100222848-100222870 TGCTGGAAAGACACTGGGTTTGG + Intergenic
1195102846 X:101572755-101572777 TGTCAAAAAGATATTGGGGTGGG + Intergenic
1195538678 X:106037847-106037869 AGCCAGAAAGATAAGGTGTAAGG + Intronic