ID: 1028567290

View in Genome Browser
Species Human (GRCh38)
Location 7:92246559-92246581
Sequence TCGGAGCCACAAATGGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028567290_1028567294 8 Left 1028567290 7:92246559-92246581 CCTCTACCCATTTGTGGCTCCGA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1028567294 7:92246590-92246612 CTACCTACTTCACACCCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 160
1028567290_1028567296 18 Left 1028567290 7:92246559-92246581 CCTCTACCCATTTGTGGCTCCGA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1028567296 7:92246600-92246622 CACACCCTCCCGGATCTACTAGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028567290 Original CRISPR TCGGAGCCACAAATGGGTAG AGG (reversed) Intronic
902459370 1:16561295-16561317 TGGGAGCCACACAAGGGCAGAGG + Intergenic
903152565 1:21421976-21421998 TGGGAGCCACACAAGGGCAGAGG + Intergenic
903160564 1:21486009-21486031 TGGGAGCCACACAAGGGCAGAGG - Intergenic
907087339 1:51687841-51687863 TCTGAGCCACAAATGTGACGAGG - Intronic
910164038 1:84304403-84304425 TCGTAGCCACATGTGGCTAGTGG - Intronic
911202496 1:95059829-95059851 ACGTAGCCACATATGGCTAGTGG + Intronic
913539171 1:119802500-119802522 TCTCAGCCACATATGGGGAGTGG - Intronic
914829837 1:151162944-151162966 GCGGAGCCATAGGTGGGTAGTGG - Intronic
916531220 1:165658572-165658594 GCTCAGCCACACATGGGTAGGGG - Intronic
916842667 1:168615751-168615773 TTGGAAACACAAAAGGGTAGAGG + Intergenic
918247289 1:182671209-182671231 TGAGAGCATCAAATGGGTAGTGG - Intronic
920258409 1:204672385-204672407 AGGGAGCAACAAATGGGTACAGG + Intronic
923475202 1:234325336-234325358 TTGGAGCCTCAACAGGGTAGTGG - Intergenic
1066336878 10:34486777-34486799 TCAGAGTCACAAAAGGGTAATGG - Intronic
1073267813 10:102238835-102238857 TCAGAGTCACAAATGGCTACAGG - Intronic
1073833493 10:107414050-107414072 TCGGAGCTACAATTGGGTGGTGG - Intergenic
1074670949 10:115790210-115790232 TGGGGGCCACCACTGGGTAGAGG - Intronic
1076614664 10:131747590-131747612 TCAGAGCCACGAATGAGGAGTGG + Intergenic
1080669381 11:34362196-34362218 TTGCAGCCACAAGTGGTTAGTGG - Intergenic
1089167440 11:116488122-116488144 TCGGAGCCATAAACGGGTCTGGG + Intergenic
1089778664 11:120857401-120857423 TCAGAGCCACAAGTGGATACGGG - Intronic
1089979396 11:122759816-122759838 CCTGAGCCACAGATGGGTACTGG - Intronic
1102927263 12:116835853-116835875 TCTGAGTCAAAAATGGGTGGAGG + Intronic
1106561918 13:30854188-30854210 TTGGAGACACAAATGGTCAGGGG + Intergenic
1113185760 13:107684106-107684128 TGGGAGCCACAGATGGCTGGTGG - Intronic
1119323459 14:73745062-73745084 TCAGAGCCACACCTGGGCAGAGG + Intronic
1119807576 14:77492183-77492205 TTGGTGCCACAAAGGGGTTGAGG - Intronic
1124368948 15:29092440-29092462 TCAAAGCCACATGTGGGTAGCGG + Intronic
1125267480 15:37900023-37900045 TGAGAGCCAGAAATGGGTAGAGG - Intergenic
1133864319 16:9627518-9627540 TCAGAGCGAGAAATGGGGAGAGG - Intergenic
1146209539 17:30931314-30931336 TGGGTGCCACAACTGGGGAGGGG + Intronic
1148480335 17:47955841-47955863 TGGCAGCCCCAAATGGGCAGTGG - Intronic
1152550661 17:81028354-81028376 TCTGAGCAACACATGGGCAGAGG - Intergenic
1162156205 19:8679508-8679530 TCAGAGCCACAAATGTGTGCAGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1202675615 1_KI270711v1_random:3479-3501 TGGGAGCCACACAAGGGCAGAGG + Intergenic
926278864 2:11428343-11428365 TAGTAGCCACATATGGCTAGTGG - Intergenic
932692193 2:73922338-73922360 GAGGAGTCACAAATGGGTGGAGG + Intergenic
934058781 2:88274830-88274852 TGAGACCAACAAATGGGTAGTGG - Intergenic
943716064 2:191152987-191153009 TCCAAGCCACATATGGCTAGTGG + Intergenic
944382482 2:199127439-199127461 TCAGAGCCAGCAATGGCTAGTGG - Intergenic
947327350 2:228992798-228992820 TGGGTGCCAGAAATGGGGAGAGG + Intronic
947463783 2:230324178-230324200 TCTGTGCCCCAGATGGGTAGAGG - Intergenic
947472603 2:230412618-230412640 TCTGTGCCGCAGATGGGTAGAGG - Intergenic
947722697 2:232379288-232379310 ACAGAGCCACATATGGGAAGCGG - Exonic
1169833460 20:9851768-9851790 TAGTAGCCACACATGGCTAGTGG - Intergenic
1174521561 20:51134945-51134967 TCTGAGCCACAAAAGGGAAGGGG + Intergenic
1177832517 21:26154901-26154923 TAGTAGCCACAGATGGCTAGTGG - Intronic
951657218 3:25023030-25023052 TTGGAGGGACAAATGGGTAGAGG + Intergenic
959945603 3:112122732-112122754 TCTGAGCCAAAGAAGGGTAGTGG + Intronic
960702450 3:120451246-120451268 TCCCTGCCACAAAGGGGTAGGGG + Exonic
961468949 3:127099456-127099478 TCGGAGCCACCAAAGGACAGGGG + Intergenic
962778650 3:138689341-138689363 TTCGAGCCAGAAATGGGGAGGGG - Intronic
965833014 3:172817116-172817138 TCATAGCCACAAGTGGCTAGTGG + Intronic
971297004 4:25403730-25403752 CAGCAGCCACAAATGGTTAGTGG + Intronic
984587507 4:181580390-181580412 TGGGCTCCACAAATGGGTTGGGG - Intergenic
995453545 5:112329071-112329093 TAGCAGCCACACATGGCTAGTGG - Intronic
999605521 5:153310199-153310221 TGGGTGCCACCAATGGGAAGTGG - Intergenic
1001654939 5:173342165-173342187 TCAGAGCCACACATGGCAAGTGG - Intergenic
1003131855 6:3401740-3401762 GCTGAGCAACAAATGGGTGGAGG - Intronic
1028567290 7:92246559-92246581 TCGGAGCCACAAATGGGTAGAGG - Intronic
1030609483 7:111673299-111673321 TAGTAGCCACACATGGCTAGTGG + Intergenic
1033971688 7:147048630-147048652 TAGTAGCCACATATGGTTAGTGG - Intronic
1037659472 8:20914404-20914426 TGGGAGCTAGAACTGGGTAGGGG + Intergenic
1042708031 8:71682912-71682934 TAGGAGCCAGAAATAGATAGGGG + Intergenic
1042711600 8:71723391-71723413 TCAGAGCCACAAATTGGGAAAGG - Intergenic
1047191865 8:122685645-122685667 CAGGGGCCACAAATGGGTTGTGG - Intergenic
1049082950 8:140457285-140457307 TCGGAGGCACAGAGGGGAAGGGG + Intronic
1051212963 9:14764604-14764626 TCGTTGCCACAACTGGGAAGAGG + Intronic
1060765745 9:126294013-126294035 TGGGAGCCACAGATGGGTAAAGG + Intergenic
1185931960 X:4213354-4213376 TGGGACCCACAAAAGGGTGGAGG - Intergenic
1186401882 X:9267854-9267876 TAGTTGTCACAAATGGGTAGAGG - Intergenic
1190113804 X:47612558-47612580 TGGAAGCCAAAAATGGGCAGTGG + Intronic
1190358463 X:49627265-49627287 TGGGAGGCACCACTGGGTAGGGG + Intergenic
1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG + Exonic
1194585276 X:95725334-95725356 TCGGAGCTAGCAAAGGGTAGAGG + Intergenic
1197433844 X:126400674-126400696 TTGGAGCCAGGAATGGGTATTGG + Intergenic
1197687632 X:129458791-129458813 TCAGAGGCACAAATGCGGAGTGG - Intronic