ID: 1028569716

View in Genome Browser
Species Human (GRCh38)
Location 7:92273613-92273635
Sequence AAGGGAAAACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1180
Summary {0: 1, 1: 0, 2: 9, 3: 116, 4: 1054}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028569716 Original CRISPR AAGGGAAAACAGATGGAAGA TGG Intronic
900008066 1:78566-78588 AAAAGAAAAGAGATGGAAAAAGG + Intergenic
900087738 1:906448-906470 AAGGGACTAAACATGGAAGAAGG - Intergenic
900863027 1:5246304-5246326 AAGGGAAGAAGGAGGGAAGAAGG - Intergenic
901703611 1:11058638-11058660 TAGGAAAACCAGATGGCAGAGGG - Intronic
902752538 1:18527278-18527300 AGGGGAAATCAGCTGGGAGAGGG - Intergenic
903087780 1:20878700-20878722 AAGAGAAAACAGATGATACATGG + Intronic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
904291314 1:29487831-29487853 TAGAGGAAACTGATGGAAGAAGG + Intergenic
905236415 1:36553195-36553217 AAGGAAAAACAGACGGCAGGAGG - Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905291902 1:36927632-36927654 GAGGGAAAAAAGAGGGAAAAGGG + Intronic
905337631 1:37256410-37256432 TGAGGAAGACAGATGGAAGAGGG - Intergenic
905736959 1:40335803-40335825 AAGGGAAAAGAGAGAAAAGAAGG - Intergenic
905787480 1:40769891-40769913 AGGGGAAAGCAGAGGGAAAAGGG - Intronic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906409272 1:45566090-45566112 AAAAAAAAAAAGATGGAAGATGG - Intronic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
907369047 1:53986905-53986927 AAAGGATATCAGATGGAATATGG + Intergenic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907501499 1:54884910-54884932 CAGGGCCAACAGATGGCAGAGGG + Intronic
907680705 1:56560779-56560801 AAGGGAAAACATAGGCAAGGTGG - Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907953331 1:59204972-59204994 AAGAGAAAACAGCTTGAACATGG - Intergenic
908633710 1:66138797-66138819 AAGGGAAAACACTTGAAAGAAGG - Intronic
908791066 1:67782107-67782129 AAGGCAAAACAGATGTAAAAGGG + Intronic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909219076 1:72931323-72931345 AAGGGAGAAAGGATGGAACAAGG - Intergenic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909349476 1:74634020-74634042 AAGGTACAACAGATAGAAGTAGG - Intronic
909559497 1:76993820-76993842 AATTGAAAACAGAAGGAATATGG - Intronic
910158840 1:84252162-84252184 AAGACGTAACAGATGGAAGAGGG + Intergenic
910259152 1:85279157-85279179 AGGGGAAAGAAGATGGAAGAGGG + Intergenic
910279186 1:85479793-85479815 AGGGCCAAACAGATGGAAGCTGG - Intronic
910931222 1:92444341-92444363 AAGGGAAGACACAGGAAAGAAGG - Intergenic
911320645 1:96409955-96409977 AATGGAAAATTGAGGGAAGAAGG + Intergenic
911401468 1:97379964-97379986 AAGGGAAAACAAGTGCAATATGG - Intronic
911462280 1:98205971-98205993 AAGGAAAAAAGGAAGGAAGAAGG + Intergenic
912226799 1:107743094-107743116 CAGGGAAAACTGATAGGAGATGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912876385 1:113364218-113364240 AAGGGGAGAAAGATGGAACAAGG + Intergenic
912877188 1:113371734-113371756 AAGGGAAAACAGATCACGGAGGG + Intergenic
914388908 1:147200267-147200289 AAGGGAAGGCACATGGAAGAAGG - Intronic
914513100 1:148351896-148351918 AGGAGAAAGCAGGTGGAAGAGGG + Intergenic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914805115 1:150985902-150985924 AAAGGGAAACAGATGCAAGAAGG - Intronic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915797659 1:158753599-158753621 AAGGGATAACAGAAAGAATATGG + Intergenic
915919303 1:159962210-159962232 AAGGGAAAACATGGGGTAGAGGG + Intergenic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
916308573 1:163368423-163368445 GAGGGAAATCAGATCAAAGAGGG + Intergenic
916712854 1:167427321-167427343 ATGTGAAAACACTTGGAAGATGG - Exonic
916755078 1:167761643-167761665 AATGGAAAGCAGATGGATTAGGG + Intronic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
916923656 1:169494996-169495018 AAAAAAAAAAAGATGGAAGAGGG + Intergenic
916928742 1:169551542-169551564 AAGGGATCAGAAATGGAAGAAGG + Intronic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917379197 1:174385098-174385120 AAGGGAACAAAGGTGGAAGCAGG + Intronic
917402429 1:174665361-174665383 AAAGGAAAAGAAAAGGAAGAAGG - Intronic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
917981511 1:180272345-180272367 AAGGGGACAAAGATGGGAGAGGG - Intronic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919015534 1:192028879-192028901 AATGGAAAACAGAAAGAAGCAGG - Intergenic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
919606306 1:199688763-199688785 AAGGGACTACAGCTGGGAGAGGG - Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920259539 1:204679527-204679549 AGGGAAAAACATATGGAAGAAGG - Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921969688 1:221134433-221134455 AAGAGAAAAAAGATGGGAGGTGG - Intergenic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
924135063 1:240957162-240957184 TAGGAAAAGCAGGTGGAAGAAGG + Intronic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924251436 1:242137065-242137087 AGGGGAAAACAGAAAGAAAAAGG + Intronic
1062823461 10:551470-551492 AAGGGAAAGCAGCTGGAAGCAGG + Intronic
1062886045 10:1016776-1016798 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886049 10:1016816-1016838 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886054 10:1016856-1016878 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886059 10:1016896-1016918 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886063 10:1016936-1016958 AAGAGAAAAGAGATGTAACAGGG + Intronic
1063246475 10:4225038-4225060 AAGAGAAAATAAAAGGAAGAGGG + Intergenic
1063311614 10:4957822-4957844 GATGGAAAGCAGATGGAAGATGG - Intronic
1063316183 10:5008648-5008670 GGAGGAAAGCAGATGGAAGATGG + Intronic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1063540585 10:6929961-6929983 AAGAGAAAAAAGATGAAAGAAGG + Intergenic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1064216398 10:13404219-13404241 AAAGGAAAAGAAATGGAAAAAGG + Intergenic
1064804762 10:19118418-19118440 AAGGCAGAACAACTGGAAGAGGG + Intronic
1065340605 10:24701215-24701237 TGGGGAAACCAAATGGAAGAGGG - Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065780217 10:29160370-29160392 AAGGCAAACCAGTTGGGAGATGG + Intergenic
1065968588 10:30788065-30788087 AAGGGAAAAAAGGTGCAGGAGGG - Intergenic
1066021475 10:31307979-31308001 ATGGGAAAACAGATTCAACAAGG + Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067525597 10:47036510-47036532 AAGTGATAACAGATGGGAAAAGG - Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068200427 10:53776797-53776819 AAGGGAGAACACATGGTATATGG - Intergenic
1068340204 10:55691906-55691928 AAGAGAGAACAGGTGGAAGAAGG - Intergenic
1068372306 10:56132499-56132521 AAGGGAAAAAAGAGGAAACAGGG - Intergenic
1068429985 10:56919269-56919291 AATGGAAACCTGAGGGAAGAAGG - Intergenic
1068647270 10:59481443-59481465 AAGGGAACACTGGCGGAAGAAGG + Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069152336 10:64979330-64979352 AGGAGAAAACGGAGGGAAGAAGG - Intergenic
1069167475 10:65180483-65180505 AACGGAAAACAGAAAAAAGAAGG - Intergenic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069333869 10:67326050-67326072 AATGGAAAACAGATAAAAGCAGG - Intronic
1069409656 10:68140215-68140237 AAGGGAAGAGTGATGGGAGATGG + Intronic
1070267920 10:74922413-74922435 AAGGAAAAAAAGAAGAAAGATGG + Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071809569 10:89164726-89164748 AAGGGAAAAGAGTTGGAGCAAGG + Intergenic
1072028779 10:91496054-91496076 AAGGGGAAATAAATGAAAGAGGG + Intronic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072096058 10:92181479-92181501 AATGGCAACCAGAAGGAAGACGG + Intronic
1072529520 10:96305872-96305894 AAGAGAAATCAGGTGGAAGAAGG - Intronic
1072673026 10:97445692-97445714 AGGGAAAAACAGAGGGGAGATGG + Intronic
1072694192 10:97590851-97590873 AAGAGAAGACAGATGGGAGCAGG + Exonic
1072719748 10:97773086-97773108 TAGGGAACACAGTGGGAAGAGGG + Intergenic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1072999218 10:100273872-100273894 AAAGGAAAAGGGTTGGAAGAAGG + Intronic
1073618385 10:105021722-105021744 ATGAGAAAACAGATGAAAGCTGG - Intronic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1073946779 10:108759957-108759979 AAAGGAAAACAGATGAAAGGAGG + Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074575237 10:114662708-114662730 AATGGAGAAGATATGGAAGAGGG - Intronic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1074736632 10:116441251-116441273 GATGGAAAACAGATGGCAGATGG + Intronic
1074736775 10:116443134-116443156 GATGGAAAACAGATGGCAAATGG + Exonic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075946331 10:126436323-126436345 AAGGCAAATCAGCTGAAAGATGG + Intronic
1076088609 10:127658818-127658840 ACGGGAAAACAGATGGACTTTGG - Intergenic
1077876100 11:6307673-6307695 AAGGGAAATTGGATGGAAGATGG + Intergenic
1077915633 11:6609907-6609929 AAGAGAAAACAGATAGAAGGAGG - Intronic
1078302817 11:10150462-10150484 ATGGGATTACTGATGGAAGAGGG + Intronic
1078587152 11:12601675-12601697 AAGAGAAAAGAGATGGAAAGAGG - Intergenic
1079052184 11:17171592-17171614 AAGGGAAAATAGTTGTATGAAGG - Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079461407 11:20681932-20681954 AAGGGAAAATGGAAGGCAGAAGG - Intronic
1079654521 11:22972063-22972085 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080291235 11:30673849-30673871 AAGGGATGACAGATGGAACCTGG + Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080812270 11:35716465-35716487 AAGGGAATACAAATAAAAGAAGG + Intronic
1081353511 11:42085022-42085044 AAGGCCAATCAGATGGAAGCAGG - Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081758439 11:45560701-45560723 ATGGGAACAAAGATGGAAGGAGG - Intergenic
1081842197 11:46210687-46210709 AAGAAAAAACAGATGCTAGAGGG - Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082143681 11:48641034-48641056 AAAGGAAAGGAGAGGGAAGAAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082659806 11:55895719-55895741 AAAGGAAAAAAGGTGGAACAGGG - Intergenic
1084401735 11:68947914-68947936 ACAGGAAAAAAGATGTAAGAAGG - Intergenic
1084469693 11:69351334-69351356 GAGGAAAAAAAGATTGAAGAAGG - Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085821924 11:79803029-79803051 AAGAAAAAAGAAATGGAAGAAGG + Intergenic
1086129060 11:83382343-83382365 AAGGTAAAACAGCTGGCAGGTGG - Intergenic
1086170586 11:83831924-83831946 AAGGGAAATTAGAAGGAAGGGGG + Intronic
1086285680 11:85247487-85247509 AAGGAAAAAATGAGGGAAGAAGG - Intronic
1086508661 11:87531720-87531742 TAGGGAAAACAAATGGATAAGGG - Intergenic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1087563318 11:99819259-99819281 AAAGGAAAAATGATGGCAGAAGG - Intronic
1087592259 11:100205468-100205490 AATGGATACCAGATGGAAAAAGG - Intronic
1087949313 11:104200642-104200664 AAGGCAATATAGATGGTAGACGG + Intergenic
1088226842 11:107629895-107629917 AAGGGAAAGCAGAGGGAAAGAGG + Intronic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088696038 11:112366641-112366663 AAGGAAGAAAAGAAGGAAGAAGG - Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089125556 11:116174199-116174221 AAGGAAACACAAATGGCAGAGGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089538116 11:119173084-119173106 GAGGGACCACCGATGGAAGATGG - Intronic
1089942494 11:122433434-122433456 ATGGGAATACAGAGAGAAGAGGG + Intergenic
1090162278 11:124508383-124508405 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1090332238 11:125941389-125941411 AATGGAAAGCAGATGGAAGGAGG + Intergenic
1090380290 11:126321924-126321946 AAGACAAAAGAGATGGAAGATGG + Intronic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1092296512 12:7203401-7203423 AAGGGAAAGCAGATAGAAAAAGG - Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1092613270 12:10193517-10193539 AGGGGACAACAGATAGGAGAGGG + Intergenic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093056973 12:14565731-14565753 AAGGGAAAACAGATTAATGTGGG + Intronic
1093121229 12:15273967-15273989 AAGTGAAAGCAGTTGTAAGATGG + Intronic
1093391319 12:18627056-18627078 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1093510065 12:19916385-19916407 AAGGGATATGAGGTGGAAGAAGG - Intergenic
1093625894 12:21347701-21347723 AAGGAAAAAAGGAAGGAAGAGGG + Intronic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093791387 12:23254522-23254544 AAGGGAAGAAAGATGAAAGGTGG + Intergenic
1093859441 12:24145296-24145318 AATAGAAAACAAATGCAAGATGG + Intergenic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094064922 12:26351976-26351998 AAGGGAAAACATTTGGAATAGGG + Intronic
1094090664 12:26645441-26645463 AAGGAACCACATATGGAAGATGG + Intronic
1094516155 12:31129067-31129089 AGGGGAAAGGAGATAGAAGATGG + Intergenic
1094555624 12:31497126-31497148 AATGCAAAACAGATCGCAGAAGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096933234 12:55239357-55239379 AGGGGAAAAGAGATGGAGAATGG + Intergenic
1097614346 12:61865427-61865449 AAAGGAAGAAAGATGGAGGAGGG + Intronic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1099273448 12:80544567-80544589 AAGAGAAAATAGATGTAAAAAGG - Intronic
1099279716 12:80628814-80628836 AAAGTAGAACAGAGGGAAGAAGG + Intronic
1099536211 12:83848208-83848230 AAGGAAACACAGAGAGAAGAAGG - Intergenic
1099669830 12:85675593-85675615 AAGGGAAATGATAGGGAAGAAGG + Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1100068324 12:90679149-90679171 AAGTGAACACAGAGAGAAGATGG - Intergenic
1100176203 12:92033841-92033863 AAGGGAAAACAAGGAGAAGAAGG + Intronic
1100465186 12:94838078-94838100 AAAGGAAAAAAGAAGAAAGATGG + Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100658346 12:96670843-96670865 AAGAGAAAACAGCTAGAACAAGG - Intronic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101089417 12:101270036-101270058 AAAGGAAAACAGAGGGGACAGGG - Intergenic
1101227608 12:102705465-102705487 GATGGAAAGCAGATGGTAGAGGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101554806 12:105799081-105799103 AAGGGAAGAGAAAAGGAAGAGGG - Intergenic
1101559772 12:105845331-105845353 AATGGAAAAGACATGGCAGAAGG + Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101719652 12:107340467-107340489 AAGGGGGAAGAGATGGGAGAAGG - Intronic
1101797479 12:107988789-107988811 AAGGGAAACTACATGGATGAGGG + Intergenic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102304398 12:111793468-111793490 AAGGGGAAACTGGTGGAACAGGG - Intronic
1102464546 12:113120763-113120785 AAGAAAAATCAGATGGAAGATGG - Intronic
1102752582 12:115308546-115308568 AAGGGAAAAATGAGAGAAGAGGG - Intergenic
1103058911 12:117843200-117843222 AAGGGAACACCGAGGGATGAAGG + Intronic
1104008494 12:124912702-124912724 GCCGGAAAACAGCTGGAAGATGG - Exonic
1104008555 12:124913158-124913180 GCCGGAAAACAGCTGGAAGATGG - Exonic
1104008621 12:124913614-124913636 GCTGGAAAACAGCTGGAAGATGG - Exonic
1104204583 12:126626147-126626169 AAGGGAAAATATATGGAAACAGG - Intergenic
1104532111 12:129581652-129581674 AGGATAAAGCAGATGGAAGAAGG - Intronic
1104679924 12:130742807-130742829 GAGGGATGACAGATAGAAGATGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106644089 13:31614382-31614404 AAGGGCAAAGAGGTGGAAGTGGG - Intergenic
1106810321 13:33352627-33352649 AAGAGAAGCCAGATGAAAGACGG + Intergenic
1106953245 13:34907715-34907737 AGGGGAATACAGAGGGAAGAAGG - Intergenic
1107031494 13:35858450-35858472 AAAGACAAACAGCTGGAAGATGG + Intronic
1107032120 13:35864019-35864041 AAGGGCAAACATTTGAAAGAAGG - Intronic
1107045011 13:35984705-35984727 AGGGGAATACAGATGGGAAAAGG - Intronic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108088968 13:46825603-46825625 AATGGAAACCAGCTGGTAGAGGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108575432 13:51786375-51786397 GAGTGAAGACAGATGGGAGAGGG - Intronic
1108882819 13:55142102-55142124 AGGTCAAAACAGGTGGAAGAAGG + Intergenic
1109038966 13:57306038-57306060 AAGGGGAAACAGAGGGGAGTAGG - Intergenic
1109230026 13:59745208-59745230 AAGGCAAAAGAGAAGGGAGATGG + Intronic
1109261637 13:60151316-60151338 AAGGGAAAACAGAGGCACAAAGG + Intronic
1109276106 13:60306208-60306230 AAGGGCACACTGATGCAAGATGG + Intergenic
1109343215 13:61088275-61088297 AAGGAAGTACAGTTGGAAGAGGG - Intergenic
1109384090 13:61604642-61604664 GTGGGAACACAGATAGAAGATGG + Intergenic
1109620884 13:64903064-64903086 AGGGGAAAACATAAGGAAAAAGG + Intergenic
1110168248 13:72469494-72469516 AAAACAAAGCAGATGGAAGAAGG + Intergenic
1110223574 13:73097018-73097040 AAGGGAGATCAGATGGTATATGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111638763 13:90940536-90940558 AGGGGAAGAGAGATGGAAGGGGG + Intergenic
1112157600 13:96834545-96834567 AAGGGAATATGTATGGAAGAAGG + Exonic
1112368967 13:98778158-98778180 AAGGGGATACAGACGGAAGGTGG + Intergenic
1112621463 13:101058124-101058146 AAAGGAAAACACATGGCAGGAGG + Intronic
1112684487 13:101808287-101808309 AAAGGATAACAGAAGGAATAGGG - Intronic
1112840546 13:103572255-103572277 AAGGGAAGAGAGGTGGAGGAAGG - Intergenic
1113125273 13:106971411-106971433 AATGGGCCACAGATGGAAGATGG + Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114518348 14:23316513-23316535 AAGGGAACACAAATATAAGATGG + Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114582505 14:23775407-23775429 AAGGGAAAATAGATCCAAGGAGG + Intergenic
1114671578 14:24414571-24414593 ACACCAAAACAGATGGAAGAGGG - Intronic
1114712828 14:24795444-24795466 AAGAAAAAACAGCTGGAAGAGGG + Intergenic
1114746393 14:25152658-25152680 AAGGGATACCTGATGGGAGAAGG - Intergenic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1115827226 14:37291774-37291796 AAGGGCAAAAAGAGGCAAGAGGG + Intronic
1115872516 14:37821052-37821074 AAAGGAAAAAAGAAAGAAGAAGG - Intronic
1116027280 14:39530488-39530510 AATGGAAAACAGAAGAAAGTAGG + Intergenic
1116055806 14:39862640-39862662 AAGGGAAAAAAGAGGGAAACAGG + Intergenic
1116392578 14:44411174-44411196 AAGGAAAGAAAGATGGGAGAAGG + Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1116851086 14:49910147-49910169 AATGGAAAAAGGATTGAAGATGG + Intergenic
1116912081 14:50479209-50479231 AAGGGACAACAGAAGAAAAAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117313162 14:54548526-54548548 AGGGGAAAACAGAGGTAACAAGG - Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1117652510 14:57921676-57921698 AAGGGAAGACAGGGAGAAGATGG - Intronic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118064001 14:62170930-62170952 AAGGGAACACAGGTAGAAGCTGG - Intergenic
1118131015 14:62963611-62963633 ATAGAAAAAGAGATGGAAGAAGG - Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118348055 14:64954078-64954100 AAGGGAAAAAAGATGCAGAACGG + Intronic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1118619481 14:67601330-67601352 TGGGGAAAACAGTTGGAAGCTGG + Intergenic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119194093 14:72704161-72704183 AAGGGATGCCAGTTGGAAGAAGG - Intronic
1119461432 14:74807643-74807665 TTGGGAAAACAAATGGAAGGAGG + Intronic
1119914771 14:78387677-78387699 AAAGGAATACGGATGGAAGATGG - Intronic
1119959708 14:78841314-78841336 AATAGAAAACAAGTGGAAGACGG - Intronic
1119965734 14:78913759-78913781 AAGAGAAAACAGATGAAATCTGG + Intronic
1120145349 14:80972967-80972989 AAGGGAAAACAGATGTAAACAGG + Intronic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121469478 14:94140740-94140762 AAAGAAAAACAGATGGCAGCAGG + Intergenic
1121677600 14:95766825-95766847 AAGGGAAAACAATGGGCAGAAGG - Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1122362075 14:101173519-101173541 AAGGGAAGAGAGAAGCAAGAGGG - Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1124690539 15:31817994-31818016 ATGGCAGAAGAGATGGAAGAGGG - Intronic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126473673 15:49044637-49044659 TAGGAAAAAAACATGGAAGAAGG - Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126932634 15:53671932-53671954 AAGAGAAAAAAAAGGGAAGAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1127490026 15:59453775-59453797 AAGGGAGAAGAGCTGGAAGAGGG + Intronic
1127587063 15:60388577-60388599 AAAGGAAAAAAAATGGAAAAAGG - Intronic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1128926713 15:71662934-71662956 AAGGGAAGGCAGAGGGAAAATGG + Intronic
1129353676 15:74973060-74973082 AAAGGAAAAGAGATGGAAGGAGG - Intronic
1129591289 15:76917066-76917088 AAAAGAAAACAGATGCTAGATGG + Intergenic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130387974 15:83428813-83428835 AAGGGAACAAAGCTGGGAGAAGG + Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130560731 15:84956233-84956255 AAGGGAGGACAAATGGAATATGG - Intergenic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1131081402 15:89539274-89539296 AAGGGAAAAGGAAAGGAAGAAGG + Intergenic
1131437382 15:92434220-92434242 AAGGGAAAAAAAAAGAAAGAGGG - Intronic
1131937779 15:97525791-97525813 AAGGGGAAAAGGATAGAAGAAGG + Intergenic
1132445490 15:101913544-101913566 AAAAGAAAAGAGATGGAAAAAGG - Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1133342933 16:5049039-5049061 AATGGAAACCAGAAGGAAGAAGG + Intronic
1133430586 16:5733710-5733732 AAGGGAATAAAGAGGTAAGAGGG - Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1134351827 16:13444796-13444818 AAGGGAAGATGGAGGGAAGAGGG - Intergenic
1134535432 16:15023147-15023169 AAATGAAAACTGATGGCAGAAGG - Intronic
1134811631 16:17172221-17172243 AAGGAAAGAGAAATGGAAGAGGG - Intronic
1134833138 16:17339847-17339869 AAGGGAGAAAAGACGGAAGGAGG - Intronic
1135168749 16:20164623-20164645 AAGGGAGAGGAGATGAAAGATGG - Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136060889 16:27725706-27725728 AAAGGCAAACAGATGGACCATGG - Intronic
1137951023 16:52783463-52783485 AAGGGAAGACAGAAGCAACATGG - Intergenic
1138217876 16:55221077-55221099 AAGGGAAAAGAGAAAGAATAAGG + Intergenic
1138556783 16:57775535-57775557 TGGGGAAAGCGGATGGAAGATGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139860612 16:70017645-70017667 AAATGAAAACTGATGGCAGAAGG + Intergenic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1140065597 16:71608777-71608799 AAGGGAAAAAAGGCAGAAGAGGG - Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140308072 16:73822185-73822207 AAGAGAAAACAGATGCCAGAAGG - Intergenic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140499465 16:75421239-75421261 AAGGGAAAAAAGGGGGAACAGGG - Intronic
1140582243 16:76245203-76245225 AAAGAAAAACAGAAGGAAGTGGG + Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1140964108 16:79947530-79947552 AGGAGAAAAGAGATAGAAGATGG + Intergenic
1141285341 16:82666763-82666785 AAGGTCACACAGATGGAAGCTGG + Intronic
1141382562 16:83589241-83589263 AAGGGGAAAGAGAGAGAAGAGGG - Intronic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141898342 16:86972839-86972861 AAGCAAAGACAGATGGTAGATGG + Intergenic
1142013646 16:87731459-87731481 GGGGGAAAAAAGATGGAAAAAGG + Intronic
1142259474 16:89036123-89036145 GAGGGAGGACAGCTGGAAGAAGG - Intergenic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143586615 17:7853713-7853735 AAAGGAAAAAAAATGGGAGACGG + Exonic
1143772700 17:9178754-9178776 AGGGGAACACCGAAGGAAGAAGG - Intronic
1144325153 17:14172097-14172119 AGTGGAAGACAGATGGAAGGAGG - Intronic
1144474029 17:15568976-15568998 AGTGGAAGACAGATGGAAGGAGG - Intronic
1144529042 17:16018402-16018424 ATGAGAAAACTGATGGAAGAGGG - Intronic
1146757457 17:35445907-35445929 GAGGGAAAACACATTGAATAGGG + Intronic
1147205107 17:38831815-38831837 AAGGAAAAAAGGAAGGAAGAAGG - Intergenic
1147532891 17:41296697-41296719 AAGGGAAATAAGACTGAAGAGGG + Intergenic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1149018587 17:51937100-51937122 AAGGGAAAGCAAATGAAAGTTGG + Intronic
1149096741 17:52850856-52850878 AATGAAATAAAGATGGAAGATGG - Intergenic
1149540910 17:57467529-57467551 AAGGAAGAACTGATGAAAGATGG + Intronic
1149544439 17:57492936-57492958 AGTGGAAAACTGATGGAAAATGG - Intronic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1149938654 17:60838129-60838151 AAGGGAGAATAGATAGAAAATGG + Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151608172 17:75153659-75153681 AAGGGGAGACACTTGGAAGAGGG + Intronic
1151841376 17:76620486-76620508 AAGGGATAAGAGATTGAATAAGG - Intergenic
1152035354 17:77868939-77868961 AAGAGAAAAGAGCTGGGAGAAGG + Intergenic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1152358954 17:79821353-79821375 AAGGGAAAAATGATGTAGGAGGG - Intergenic
1152529542 17:80909221-80909243 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1153583134 18:6595605-6595627 AAGGTAACACAGATGGTAAATGG + Intergenic
1153997167 18:10453522-10453544 GGGGGAAAACTGCTGGAAGAGGG + Intergenic
1154229532 18:12542477-12542499 ATGGGAAAACAAATAGAAGATGG - Intronic
1155049772 18:22136513-22136535 ATGAGAAAACAGCTGGAAGGAGG + Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155442008 18:25871873-25871895 AAAGAAAAAGAGAAGGAAGAAGG + Intergenic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156776200 18:40792367-40792389 AAAGGAAGAGAGAAGGAAGAAGG - Intergenic
1156869506 18:41929189-41929211 AAAGGAAATGAGATGGGAGAAGG - Intergenic
1156931211 18:42646233-42646255 AAAAGAAAAGAGAGGGAAGAAGG + Intergenic
1157110481 18:44816068-44816090 CAGGGACAATAGATGAAAGAAGG + Intronic
1157175154 18:45445022-45445044 AATGCAAAACAAATGGATGATGG + Intronic
1157497919 18:48169709-48169731 AAGAGAAAACAGATGTGAAATGG - Intronic
1157560468 18:48641884-48641906 AGGGGATAACAGATGGTAGGTGG + Intronic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1158005982 18:52672631-52672653 AAGGGGAAAAAGAGGAAAGAGGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1159928117 18:74286832-74286854 AAGGGAAAACACATGCAAGCCGG - Intronic
1160214669 18:76917988-76918010 AAGGGAAAAAAGATGAGAGATGG - Intronic
1160639820 19:120163-120185 AAAAGAAAAGAGATGGAAAAAGG + Intergenic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161228246 19:3158033-3158055 AAGGGAAAACAGATTCAATGAGG - Intronic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1161843445 19:6696238-6696260 GAGGGAAAACAGATCACAGATGG + Intronic
1161886305 19:6998833-6998855 AATGGAAAACAGAAAGATGAAGG - Intergenic
1162085923 19:8249094-8249116 ATGGGCGAACAGATGGATGATGG + Intronic
1162090430 19:8276218-8276240 AATGAAAAAGAGATGGAAGCGGG - Intronic
1162092663 19:8291051-8291073 AATGAAAAAGAGATGGAAGCGGG - Intronic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1163203748 19:15787413-15787435 AAGGGAGGAAAGATGGAAGAAGG + Intergenic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1165476812 19:36035397-36035419 GAGGGACAAAAGATAGAAGATGG - Exonic
1165561560 19:36684976-36684998 AGGGGAAAACAGATGTAAAAAGG + Intergenic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167406120 19:49309913-49309935 AAGGAAAAAGAAATGGGAGAGGG - Intronic
1168102296 19:54147734-54147756 AAGGAAAAACAGCTGGAAATTGG - Intronic
1168374955 19:55869133-55869155 AGGGGAACCCAGATGGAAGTTGG + Intronic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925062427 2:903575-903597 AGGGTAAATCAGAAGGAAGAAGG - Intergenic
925443319 2:3907074-3907096 AGGGAAAAACGGAGGGAAGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925736141 2:6965548-6965570 AAGCGCAAACAGCGGGAAGATGG + Intronic
925768891 2:7263252-7263274 AAGGAAAGAAAGATGGATGAAGG - Intergenic
926271108 2:11366716-11366738 ATGGAAAAAAACATGGAAGAGGG - Intergenic
926502124 2:13668849-13668871 AAGGCAAATCAAAGGGAAGATGG + Intergenic
926503495 2:13682686-13682708 AAGGGGAAACAACTCGAAGAGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927647097 2:24884832-24884854 AAGGGAAAAAAGATGGTAAAAGG - Intronic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928354036 2:30592122-30592144 TATGGGAAACAGATTGAAGAGGG - Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
929048313 2:37812576-37812598 ATGAGAAAACAGACGCAAGAGGG + Intergenic
929382288 2:41367287-41367309 AATGGAAAACAGAAGAAAGCAGG + Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929548019 2:42868759-42868781 AAAGGAAAACAGAAAGAAGGAGG - Intergenic
929606003 2:43234636-43234658 AAGGGAAAAAAGAAAGAAAAAGG - Intronic
929913706 2:46115846-46115868 AAGAGAAAACAGAAGGCAAAGGG - Intronic
929983556 2:46702926-46702948 AAAGGACCACAAATGGAAGAAGG - Intronic
930586661 2:53275506-53275528 AATGGAAATCAAGTGGAAGAAGG - Intergenic
930975001 2:57446791-57446813 GAGGGAAAGCAGAGGAAAGAGGG + Intergenic
930982835 2:57548117-57548139 AAGGGAAAAAAGAGGAAGGAAGG + Intergenic
931137250 2:59416801-59416823 AAAGGAGAACAAAAGGAAGAAGG + Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931557556 2:63521375-63521397 AATGGAAAACAGAAGAAAGCAGG + Intronic
931591586 2:63889349-63889371 GAGGGAAAAAAGACTGAAGAGGG + Intronic
931899557 2:66772463-66772485 TAGGGAAAACTGATGAAAGGAGG + Intergenic
931992014 2:67799896-67799918 AGGGAAAAGCATATGGAAGAAGG + Intergenic
932067567 2:68582517-68582539 AAGGGAATACAGAAAGTAGAGGG + Intronic
932174482 2:69586999-69587021 AAGGCAGAAGATATGGAAGAAGG - Intronic
932226777 2:70047665-70047687 AAGGGAAAATAAAGGGGAGAGGG + Intergenic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933097747 2:78209120-78209142 AAGGGAGAAGAGTTGGAAGGGGG + Intergenic
933172355 2:79138079-79138101 ATAGGAAAACACAGGGAAGAGGG + Intergenic
933465370 2:82644034-82644056 AATGGAAAACAGATAAAAGCAGG + Intergenic
933469544 2:82703844-82703866 AAGGAAAAACTGATGGTAGTTGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
933721372 2:85399477-85399499 AAAGGAAGACAGATGGCAGGTGG - Intronic
933833656 2:86229579-86229601 AAAGGAAGACAGGTGAAAGATGG - Intronic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935946851 2:108294394-108294416 AGGGGAAAACAGAAGAGAGAGGG - Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936616928 2:114057332-114057354 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
936719407 2:115232523-115232545 AAGGGAAATCAGAAGGCACAAGG - Intronic
936913557 2:117616635-117616657 AGGGGAAAACCAATGGAATAGGG + Intergenic
936914042 2:117621672-117621694 GAAAGAAAACAGATGAAAGAAGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937302230 2:120850101-120850123 AACAGAAAACAGACGGGAGAAGG + Intronic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937792941 2:125981656-125981678 CAGGGAAACCATTTGGAAGATGG - Intergenic
937890661 2:126936165-126936187 AAGGGAAGACAGACGGCAGGAGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
938577870 2:132620671-132620693 AAGGGAAAACAGAGAGGCGAGGG - Intronic
938609283 2:132930466-132930488 AAAGGTAAAAAGGTGGAAGAAGG + Intronic
938662710 2:133504038-133504060 AATGGAAAACAGATCACAGAGGG - Intronic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939173283 2:138720916-138720938 AATGCAAAACAGATGGAAATAGG + Intronic
939183637 2:138833679-138833701 AAGGATAAAGAAATGGAAGAAGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940140608 2:150487176-150487198 AAGGGAAAACGGATGAAAGCGGG + Intronic
940211748 2:151262135-151262157 AAGGGAAAACACATAGTAGGTGG + Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940497630 2:154453538-154453560 TAGGGAAGGCAGATGGGAGAAGG - Exonic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
941198587 2:162480840-162480862 AAGGAAAAAGAGGTGGAAAAAGG + Intronic
941294212 2:163715590-163715612 AATGGAAGACAGAGGAAAGAGGG + Intronic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942208503 2:173647499-173647521 AAAGTAAAATAGAAGGAAGAAGG - Intergenic
942818390 2:180080480-180080502 AAGGGAAAAAGGAGGGGAGAGGG - Intergenic
942920288 2:181364968-181364990 AAGGGAGAAGGGATGTAAGAAGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943113967 2:183643246-183643268 AAAAAAAAAAAGATGGAAGATGG - Intergenic
943245718 2:185448514-185448536 AGGTGAAAACAAATTGAAGAGGG + Intergenic
943322871 2:186467476-186467498 AATAGAAAACAGCTGGAAAATGG + Intergenic
943515076 2:188875274-188875296 AAGGGAAAACGAAAGGTAGAAGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943936969 2:193931666-193931688 AAGGGAGAAAGGAAGGAAGAGGG + Intergenic
943986942 2:194635109-194635131 ATGGTAAAAAAGATTGAAGATGG - Intergenic
944318979 2:198313594-198313616 AAGGGGAAACAGAGGAGAGAAGG - Intronic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
945658046 2:212649767-212649789 AAGGTGACAAAGATGGAAGAAGG + Intergenic
945950135 2:216031517-216031539 AAGGGAAAAGAAAAGAAAGAAGG + Intronic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946524810 2:220507241-220507263 AAAGGAAAAAAAATGGAAGAGGG - Intergenic
946531799 2:220578327-220578349 AAGGGAAAGGAGATGGGAGTTGG + Intergenic
946760146 2:222985457-222985479 TAGGCTAAACACATGGAAGATGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946973817 2:225125252-225125274 GAGGGAAAAGATATGCAAGATGG - Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948375737 2:237519199-237519221 AAGGGGAAGCAGCTGGAAGAAGG + Intronic
948723707 2:239919239-239919261 AAGAGAAAACAGCCCGAAGAGGG - Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1168803522 20:659553-659575 AAGAGTCAAAAGATGGAAGATGG - Intronic
1169431143 20:5537616-5537638 AAGAGAAGAAAGATGAAAGAAGG + Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171081706 20:22193163-22193185 AATGGAAAACAGAAGAAAGCAGG + Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1172594496 20:36141032-36141054 AAGGGACAGCAGCTGGGAGAAGG + Intronic
1172837946 20:37885029-37885051 AAGGGAAAAAGCATGGAGGAAGG - Intergenic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173416054 20:42856887-42856909 AAGGGAGAGAAAATGGAAGATGG + Intronic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1173857561 20:46260498-46260520 ACGGGGAAAGGGATGGAAGAAGG - Intronic
1173998234 20:47356307-47356329 AGGGGAAGAGAGAGGGAAGAGGG + Intronic
1174905876 20:54550568-54550590 AACGGAAAACAGATTAACGATGG - Intronic
1175507970 20:59499793-59499815 AAGGGAAGACAGAGAGAACAAGG + Intergenic
1175640913 20:60629442-60629464 AATGGAAGACAAGTGGAAGATGG + Intergenic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177059619 21:16354507-16354529 AAATGAAAACAGATGGTACAGGG - Intergenic
1177675903 21:24297987-24298009 ATGGGAATACAGATGTCAGAGGG + Intergenic
1177915928 21:27088202-27088224 AAAGGAAAAGAGAATGAAGAAGG - Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178225369 21:30710928-30710950 AAGGGAAAGGAGAGGCAAGAAGG + Intergenic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178660187 21:34501284-34501306 AAAGGAAAACTGATAGAAAAAGG + Intergenic
1179255973 21:39715575-39715597 AATGGAAAATAAATGGATGAAGG - Intergenic
1179570226 21:42274187-42274209 AAGGGAAAATACAGGGAAGGTGG + Intronic
1180055141 21:45354161-45354183 AAGGTCGAACAGATGGAATATGG - Intergenic
1180574807 22:16763056-16763078 AATGGAAACCATATGGTAGAAGG - Intergenic
1180589616 22:16925864-16925886 AATGGAAAACAGAAAAAAGAAGG + Intergenic
1180757307 22:18170966-18170988 AAGGGAAAACAGAAAGGACATGG - Intronic
1181074472 22:20366499-20366521 AAGGGAAAACAGAAAGGACATGG + Intronic
1181507240 22:23367898-23367920 AAGGGAAAAATGGTGGTAGATGG + Intergenic
1181879060 22:25963025-25963047 AAAAGAAAACAGGTTGAAGAGGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182015442 22:27035418-27035440 AAAGAAAAAAAGAAGGAAGAGGG - Intergenic
1182373328 22:29827688-29827710 AAGTGCCAACAGATAGAAGAGGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1183405324 22:37627720-37627742 AGAGGAAAACAGAAGGAAGCTGG - Intronic
1183908311 22:41059734-41059756 AAAGGAAAACAGTTGGCAGTTGG - Intergenic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
949237414 3:1826652-1826674 CAGGGAAAACACATAGAACAGGG - Intergenic
950159354 3:10747996-10748018 AAGGCAAAAAGGCTGGAAGAAGG + Intergenic
951303168 3:21023471-21023493 AAGGCAAGACACATGGAAAAGGG + Intergenic
951858783 3:27227334-27227356 AAGGGGAAAGACATGGAAGCAGG + Intronic
951914426 3:27784931-27784953 AAGGGAAAACTTAGGGAAGGTGG - Intergenic
951991543 3:28680607-28680629 AAGGTGAAAAACATGGAAGATGG + Intergenic
952012731 3:28919389-28919411 AAGGGAACCCAGTTGGTAGATGG + Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952590117 3:34942518-34942540 AAGGAAAAAGGGAAGGAAGAAGG - Intergenic
952637104 3:35545702-35545724 AAAGGCAAACAGACTGAAGATGG + Intergenic
953711207 3:45272779-45272801 AAGGAAAAACAGGTGGAAACAGG + Intergenic
953881105 3:46691901-46691923 AAGGACAAACAGGTGGAAGGGGG + Intronic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
955244807 3:57214890-57214912 AAGGGAATATAGATGAAGGAGGG + Intronic
955603441 3:60672774-60672796 AAGGCAAGAAAGAAGGAAGAAGG - Intronic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
956103380 3:65791463-65791485 AAGGGACATTACATGGAAGAAGG + Intronic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957573739 3:81983102-81983124 CAGGAAAAACACATTGAAGAGGG - Intergenic
957593760 3:82233830-82233852 AAAAGAAAAGAGATGGAGGAAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957825936 3:85443944-85443966 AATGGAAAACAGATGCAATTTGG - Intronic
957892285 3:86376128-86376150 AAGGGGAAGAAGATGAAAGAAGG - Intergenic
958742068 3:98086533-98086555 AAGAAACAGCAGATGGAAGAAGG + Intergenic
958972490 3:100627872-100627894 AGGGGAAAAGAGAAGGAATAGGG - Intronic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960009275 3:112815809-112815831 AAGAAAAGAAAGATGGAAGAAGG - Exonic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960844248 3:121992504-121992526 AGGGGAACACAGAAGGAAGTAGG - Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961091697 3:124118259-124118281 GAGGGACTACAGATGGCAGATGG + Intronic
961172302 3:124806247-124806269 GATGGAAAAGAGATGGGAGAGGG - Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
962209269 3:133463351-133463373 AAGGAAATACACTTGGAAGAGGG + Intronic
962306747 3:134294223-134294245 AAGGGAATAAAGGTGAAAGAAGG + Intergenic
962907256 3:139815424-139815446 AAGGAAAAATAGAGGGGAGAAGG - Intergenic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963224764 3:142851041-142851063 AAGGGAAGACAGATGTAGGTAGG + Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963475614 3:145799885-145799907 AAGGGTAAACACTTGGAAGGAGG - Intergenic
963490639 3:145995728-145995750 AAGGGAAATCAGATTGCAGATGG - Intergenic
963710888 3:148746378-148746400 AAGAGAAAATAGATTGAAGCAGG + Intergenic
964282114 3:155079125-155079147 AAGGGAAGAAAGAGGGAAGCGGG + Intronic
964329634 3:155588187-155588209 AAGGGAAAAAATATGAAATAAGG - Intronic
964472778 3:157072086-157072108 AAGGAAAAAAAGAGAGAAGAAGG + Intergenic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965368602 3:167830845-167830867 AAGGGAGAACAGATGAATGGTGG - Intergenic
965413781 3:168366724-168366746 GAGAGAAAAAAAATGGAAGATGG + Intergenic
965480412 3:169211969-169211991 ATGGGAAAACAGATGGCAGGTGG - Intronic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965551899 3:169974835-169974857 AATGGACAACAGATCGCAGAAGG - Intronic
965613716 3:170571163-170571185 ATGGGAGAACTGATGGCAGAAGG - Intronic
967210230 3:187162040-187162062 AAGGGAAGACGGAAGGAAGGAGG - Intronic
967234255 3:187368849-187368871 AAGGGAAAATTTATGGAATAGGG - Intronic
967502851 3:190220437-190220459 AATGGAAAACAGAAAGAAGCAGG - Intergenic
967663551 3:192143973-192143995 AAGGGATGAGAGAGGGAAGAAGG + Exonic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968301008 3:197614628-197614650 AAGAGAAAATAGGTGGAGGAAGG + Intergenic
969195125 4:5555561-5555583 AAGGGAATACATATGGTAAAGGG + Intronic
969341825 4:6546888-6546910 TGGGGACAAAAGATGGAAGAGGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
969839535 4:9870698-9870720 AAGGGAGAACGGCTGGAAAAAGG + Intronic
969955203 4:10882383-10882405 AAAGGAAGACAGATGAGAGAAGG - Intergenic
970052058 4:11925569-11925591 AAGGTCACACAGATAGAAGATGG + Intergenic
970406152 4:15766306-15766328 AAGGAAAAACAACTGGATGAGGG + Intergenic
970909698 4:21260475-21260497 AAGGGAAAACACTTGGATGTAGG + Intronic
971369536 4:26005393-26005415 TAGGGAAAGCAGCTGGAAGGTGG - Intergenic
971609097 4:28699133-28699155 AATGGAAAGAAGCTGGAAGATGG - Intergenic
971714453 4:30157675-30157697 AAAGCAAATCACATGGAAGATGG + Intergenic
971721281 4:30247761-30247783 AGGGGAAAACAGGTGCAAAAAGG - Intergenic
971797455 4:31246350-31246372 AAGAAAGAACAAATGGAAGAGGG + Intergenic
971821979 4:31569276-31569298 AAGTCAAATCAGATGGTAGAAGG - Intergenic
971851346 4:31989457-31989479 AAGGGAAAAATCATGGGAGAAGG + Intergenic
972176869 4:36419166-36419188 AAGAAAACACAGATGGCAGATGG + Intergenic
972184359 4:36510869-36510891 AAGTGAAGACAGATGAATGAAGG - Intergenic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
973158508 4:46988185-46988207 AAGGGAAAAAAAATGGGTGAGGG - Intronic
973582369 4:52357054-52357076 GAAGGAAAAGAGAGGGAAGACGG - Intergenic
974215855 4:58846682-58846704 AAGCTAAAACAGATGAAAGTAGG + Intergenic
974246371 4:59324645-59324667 AAGAAAAAACATATTGAAGAGGG - Intergenic
974266885 4:59597591-59597613 AAGAAAAAACACATAGAAGAGGG + Intergenic
974356642 4:60821074-60821096 AAGAGTAATCAGATTGAAGATGG - Intergenic
974864757 4:67566246-67566268 AATGTAAAAAAGAGGGAAGAGGG - Intronic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
974927363 4:68316796-68316818 AAGGGAAAACTGAAGCAACAAGG + Intronic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
976298764 4:83498433-83498455 AAGGAAAAAAAGAAGGAAAATGG + Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
976520998 4:86026413-86026435 AAGTGAAATCAGATAGCAGAAGG + Intronic
976652991 4:87456162-87456184 AGGGGAAGACAGCTGAAAGAAGG - Intronic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
976948257 4:90797304-90797326 AATGGAAAACAGATAAAAGTAGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977073250 4:92419713-92419735 AAGGTAAAAAGGAAGGAAGAAGG - Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977088031 4:92629513-92629535 AAGGGGAAAGAGGTGGAAAATGG + Intronic
977287359 4:95125390-95125412 TATGGAAAACACAGGGAAGATGG - Intronic
977519124 4:98058378-98058400 AATGGAAAACAGAAGAAAGCAGG + Intronic
978170649 4:105665836-105665858 AAGGGAAAGCAGCTAAAAGAAGG - Intronic
978172580 4:105691235-105691257 AGGGGAAGAGAGATGGAAGTGGG + Intronic
978479912 4:109177158-109177180 AAGACAAAAAAGATGGAACATGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978493996 4:109339834-109339856 AAGTGATGACAGATGGAAAATGG + Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978728468 4:111997976-111997998 AAGGGAAGACACCTTGAAGAGGG + Intergenic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979418670 4:120476302-120476324 GAAGGAAGACAGATAGAAGAAGG + Intergenic
979502173 4:121453236-121453258 AAGGAAAAAGAAAGGGAAGAAGG + Intergenic
979909542 4:126344542-126344564 AAGGAAAAAGAGAGGGAAGGAGG + Intergenic
979931191 4:126632961-126632983 AAGGGAGAAAAGAAGGGAGAGGG + Intergenic
979997599 4:127450726-127450748 AAGGGAAAAAAGTGAGAAGAAGG + Intergenic
980185699 4:129458402-129458424 AGGGGAAGAAAGATGGGAGAAGG + Intergenic
980253808 4:130350339-130350361 AGGAGAAAACAGAGGAAAGAGGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980400454 4:132277327-132277349 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
980720115 4:136684739-136684761 TAGGGAAAAGAGATGGAAAGGGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982140315 4:152311056-152311078 ATGGGAAAACAGGTTGGAGAGGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982597193 4:157401539-157401561 GAGGGAAAACAGAAGGCAAATGG + Intergenic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
982909850 4:161126415-161126437 AAGGGAAAACGCATTGAAAAAGG - Intergenic
983476963 4:168224911-168224933 AAGGGAAAATAGATACAAAAAGG - Intronic
983583425 4:169331339-169331361 AAGGAAAAACAGAAGGGATAAGG - Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984170422 4:176351768-176351790 AAGAGAAAATAGGGGGAAGAAGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984436278 4:179714010-179714032 AGAGGAAGACAGAGGGAAGAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984998867 4:185465433-185465455 AAGGAAGAAGAGATGGAAGATGG - Intronic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986573689 5:9191175-9191197 AAAGGAATAAAGAAGGAAGAAGG + Intronic
986654951 5:10001858-10001880 AATGGAAAACAGAAGAAAGCAGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
986774896 5:11005416-11005438 AATGGAAAATAGACTGAAGATGG + Intronic
986879083 5:12147813-12147835 AAGGAAAGAAAGAGGGAAGAAGG - Intergenic
986886692 5:12246521-12246543 ATGGGAAAACAGAAGACAGATGG + Intergenic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987289456 5:16494868-16494890 AAAAGAAGACAGATGGATGAAGG + Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987670747 5:21004215-21004237 ATGGGAAAACAGATCCAAGTAGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988404706 5:30809435-30809457 AAGGGAAAATAAGTGGAAGCTGG - Intergenic
988418670 5:30978292-30978314 AAGGGGAACCAAATGAAAGAGGG - Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069662 5:37497271-37497293 AAGGGAAAAGGGAGGGAAAAGGG - Intronic
989176210 5:38529075-38529097 AAGGGTAAACTGATGAAAGTGGG + Intronic
989200860 5:38761915-38761937 AAGGGACAACACATGGCACATGG + Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
989781456 5:45269907-45269929 AAGGGAAAGTAGAGGGAACATGG - Intronic
989826384 5:45861741-45861763 AGGTGAACACATATGGAAGAGGG + Intergenic
990027621 5:51214420-51214442 AAGGAAAAAGAGATGCAAAATGG + Intergenic
990250301 5:53907216-53907238 ATGGGAAAATAGATGGAATGTGG - Intronic
990271777 5:54149640-54149662 AAGGGAACAGAGATACAAGAAGG + Intronic
990523785 5:56605324-56605346 AAGGGAGACCTGATAGAAGATGG - Intronic
991027830 5:62050179-62050201 AATGGAAAACAGATAAAAGCAGG - Intergenic
991037263 5:62140366-62140388 AAAGGACAACAGATGGAACCAGG + Intergenic
992675659 5:79103454-79103476 AAAAAAAAACAAATGGAAGAGGG + Intronic
992987728 5:82250875-82250897 AAGGGAAACCAGATTCAAGTTGG + Intronic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
994186864 5:96824512-96824534 AAGAGAAAAGAGATAGGAGATGG - Intronic
994286709 5:97977845-97977867 AAGAGAAAACAATGGGAAGATGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994609196 5:102014549-102014571 AAGGGAAAAGGGAAGGGAGAGGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994633412 5:102314004-102314026 AAGGGAACTCAGAGGGGAGAGGG + Intergenic
994723664 5:103409592-103409614 AGTAGAAAACAGATGGAAAAAGG + Intergenic
994758727 5:103827135-103827157 AAGGGAAACCAGATGGGAATGGG + Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
995428817 5:112051693-112051715 AATGGAAAACAGAAGAAAGCAGG + Intergenic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
995796794 5:115949752-115949774 AAGGAAAACCAGATAGAAGAAGG + Intergenic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996078162 5:119222749-119222771 AAGGGAGATGAGATGGCAGAAGG - Intronic
996387534 5:122925091-122925113 AAGGGAAGAGAGAGGGAAGGAGG - Intronic
996549139 5:124711940-124711962 ATGGGAAAACAGATGAGACAGGG + Intronic
997170635 5:131716189-131716211 TATGGAAGACAGAAGGAAGAAGG + Intronic
997275359 5:132582621-132582643 AAAGGAAAACAGATCTAAGTAGG - Intronic
997592493 5:135084180-135084202 ACTGGAAAGCAGATGGATGAGGG - Intronic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000266835 5:159646260-159646282 AAAGGATAACAGATGAGAGATGG + Intergenic
1000301012 5:159955856-159955878 ATGGGAAAAGAGCTAGAAGAGGG - Intronic
1000452615 5:161408712-161408734 AGGGAAAAACAGAGGGAAGGAGG + Intronic
1000642090 5:163715161-163715183 AATGGAGACGAGATGGAAGAGGG - Intergenic
1000745537 5:165028039-165028061 AATGGAAAGCAGTTGGAAGCTGG + Intergenic
1000807845 5:165819256-165819278 AAGGGAAAAGAGAGAGAAAATGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001472880 5:172027524-172027546 GAGGGAAAAAAGATGGGAAAAGG - Intergenic
1001630062 5:173168320-173168342 AAGGGAAAAGAGACCCAAGAAGG - Intergenic
1001791222 5:174459414-174459436 AAGGCAAAAAAGAAGAAAGAGGG + Intergenic
1001855551 5:175007549-175007571 AAGGGAAAAGGGAGGGAAGAAGG - Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002747171 6:68570-68592 AAAAGAAAAGAGATGGAAAAAGG + Intergenic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003557769 6:7156185-7156207 AAGGGAACAGAGGTGGGAGAGGG + Intronic
1003782379 6:9443981-9444003 AAGGGGTAACAGATGGCAAATGG + Intergenic
1004229512 6:13818398-13818420 AGGAGAAAAGAGATGGAAGATGG + Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004585242 6:16993349-16993371 AAAGGAAAACAGATAGAAAAGGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004758567 6:18640801-18640823 AAGGGAACAGAGATAGAGGAAGG - Intergenic
1004759687 6:18652815-18652837 AACGAAAAACAAATGGAAGGAGG + Intergenic
1004798165 6:19113116-19113138 AAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004995992 6:21193668-21193690 AAGGGAAAAAAGTCTGAAGAGGG - Intronic
1005378816 6:25213143-25213165 AAGTGAGAACACATGGAGGAAGG + Intergenic
1005500614 6:26426141-26426163 AAGGAAAAAAAGAGGGAAGTAGG - Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1005740397 6:28785782-28785804 AAGGAAAAGAAGATGTAAGAAGG - Intergenic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007013344 6:38438816-38438838 AAAACAAAACAGAAGGAAGATGG + Intronic
1007046191 6:38776736-38776758 AAGAGACACCAGATGGATGAAGG + Intronic
1007509758 6:42365975-42365997 ATGGGAAACAAGATTGAAGAAGG - Intronic
1007821496 6:44563663-44563685 AGGGGACAACAAAAGGAAGATGG + Intergenic
1008350615 6:50485145-50485167 AAAGGTAAACAGATTAAAGAAGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008921715 6:56849922-56849944 AAGGGAAGATAGATGAAAGGAGG - Intronic
1009036592 6:58124535-58124557 AAGGGAACAGAGATGGTTGAAGG + Intergenic
1009212403 6:60878159-60878181 AAGGGAACAGAGATGGTTGAAGG + Intergenic
1009332713 6:62443863-62443885 AATGGAAAACAGAAGAAAGAAGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009816737 6:68746859-68746881 AAGGGAAAGCAAATGGACTATGG - Intronic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1010892723 6:81334239-81334261 AAGGGAGCACATATGGAAGGAGG + Intergenic
1010971776 6:82270546-82270568 AAGTGAGAAGAGTTGGAAGAGGG + Intergenic
1011050375 6:83141459-83141481 AAGGGAACACATAGGGAAGTGGG + Intronic
1011712318 6:90067240-90067262 AAGGGAACAGAGATAAAAGACGG + Intronic
1011719865 6:90144357-90144379 AGGGAAAAACAGAGGGAAGGAGG + Intronic
1011940110 6:92832699-92832721 AAGAGAAAATAGGGGGAAGAAGG - Intergenic
1011982427 6:93398596-93398618 AAAAGAAATCAGATGGAACAGGG + Intronic
1012053134 6:94369338-94369360 AGGAGAAAAAAGATAGAAGATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012422131 6:99077234-99077256 AAGGGAACACAGATGATAAATGG + Intergenic
1012527099 6:100191065-100191087 ATTGGAAAAAAGATGGAACAGGG + Intergenic
1012681204 6:102183484-102183506 AAGGGAAAAGGGAGGGAAGGAGG - Intergenic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1012863710 6:104593010-104593032 AAGGGAAAACATCTGGAACTAGG - Intergenic
1012870679 6:104669802-104669824 AAGGGAGAACACATGGTATAAGG - Intergenic
1012984228 6:105857836-105857858 AAAGGAAAACAGATGGAAATAGG - Intergenic
1013167720 6:107608811-107608833 AAGGGAAAAAGTATCGAAGAGGG + Intronic
1014464287 6:121736849-121736871 AATGGAAAACAGAAAGAAGCAGG - Intergenic
1014855845 6:126399500-126399522 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014855847 6:126399556-126399578 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1014890091 6:126833452-126833474 AAGGAAAAAAGAATGGAAGAAGG + Intergenic
1015382846 6:132589303-132589325 AATGAAACAGAGATGGAAGATGG + Exonic
1015552168 6:134423056-134423078 TAGGGAACTCAGATGGAAGTGGG + Intergenic
1015637761 6:135295713-135295735 AAGGGAAGAAAGATGTAGGAGGG + Intronic
1015920998 6:138266349-138266371 AAGGGAAAACGGAAGGGAAAAGG + Intronic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1016267057 6:142244996-142245018 AAGGGAAAACACACTGAAAAAGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016483913 6:144513557-144513579 AAAGAAAAAAAGATTGAAGAGGG + Intronic
1016792526 6:148080303-148080325 AAGGGAAAAAGGATAGAAGATGG - Intergenic
1017027521 6:150194276-150194298 AAGGTAACAGAAATGGAAGAGGG - Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017047191 6:150357671-150357693 AAGGAAATAGAGATGGCAGAGGG + Intergenic
1017307326 6:152934266-152934288 AATGGAGAACAGAAGGAATAGGG + Intergenic
1017604791 6:156122458-156122480 ATGGGAAAACAGTTCAAAGAAGG - Intergenic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1017684993 6:156904233-156904255 GAGGAAAAAAATATGGAAGAAGG - Intronic
1017996594 6:159536902-159536924 AAGGGCAAACAGAGAGGAGAAGG + Intergenic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019151732 6:170010953-170010975 AAGGGAAAGGAGAGGGAATAAGG + Intergenic
1019410780 7:905733-905755 AAGGGAAAGGAGAAGGGAGAAGG + Intronic
1019489763 7:1306821-1306843 AAGGGAATACATATGGGAGGAGG + Intergenic
1019886341 7:3909203-3909225 AATGGAAAACAGGTGTATGATGG - Intronic
1020412863 7:7912415-7912437 AAAGAAAAACAAAGGGAAGAAGG - Intronic
1020996791 7:15275857-15275879 AATGGAAAACAAATGCAAGCAGG - Intronic
1021414126 7:20362247-20362269 AAGAGAAAACGGTTGGAATATGG + Intronic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1021772365 7:24018229-24018251 GAGGGAAAACAGATGTAAATAGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1023409157 7:39871506-39871528 AAGGGCAAACTGGTGGATGATGG - Intergenic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1024624828 7:51197836-51197858 AATGGAAAACAGAAGAAAGCAGG - Intronic
1025043773 7:55672529-55672551 AAGGGCAAACTGGTGGATGATGG + Intergenic
1025136699 7:56421044-56421066 AAGGGCAAACTGACGGATGATGG + Intergenic
1025727360 7:64079043-64079065 AAGAGAATTCATATGGAAGAGGG + Intronic
1025922301 7:65924926-65924948 GATGGAAAACAGCTGGAAGCGGG - Intronic
1026022977 7:66725017-66725039 AAGGGAAAACAAATATAATAAGG - Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026697510 7:72608400-72608422 GAGGGAAAAGAGATTTAAGAGGG + Intronic
1027357407 7:77371413-77371435 AAAAGAAAAAAGATGGAGGACGG - Intronic
1027547960 7:79554291-79554313 AAGAGAAAGAAGATGCAAGAAGG - Intergenic
1027665158 7:81035700-81035722 CAGAGAAAACAGATTGAATATGG + Intergenic
1027697458 7:81430032-81430054 AGGGCAATACAGATGGCAGAGGG + Intergenic
1028001723 7:85506792-85506814 AAGTGAAAAAATAGGGAAGATGG + Intergenic
1028175086 7:87646806-87646828 AAGAGAAAACAGATTTAAAAGGG - Intronic
1028176732 7:87669298-87669320 AATGGAAAACAGAAAAAAGAAGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029078133 7:97951887-97951909 GAGGGACAAGTGATGGAAGAAGG - Intergenic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029280591 7:99433051-99433073 AAGGGAAAAGAAAGGGAACATGG + Intronic
1029444963 7:100606652-100606674 AAGGGGAAACAGACTGAAGGGGG + Intronic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031458144 7:122010343-122010365 GAGGGAAAAGACATTGAAGAAGG + Exonic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032350139 7:131154448-131154470 AAGGGAATATAGATGTAACATGG + Intronic
1032577840 7:133074290-133074312 AATGGAAATAAGATGGAAAAGGG + Intronic
1032598758 7:133270542-133270564 AAGGGAAATTTTATGGAAGAAGG + Intronic
1032644349 7:133805828-133805850 AAGGAAGAAGGGATGGAAGAAGG + Intronic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033625064 7:143102491-143102513 AAGGAAAAAAATATGGAAGAGGG + Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034634898 7:152559487-152559509 AAGGGAATAAAAAAGGAAGAGGG - Intergenic
1035032208 7:155868846-155868868 AAGTGATAACTGATGGAAGTAGG + Intergenic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1036546116 8:9771440-9771462 AAAGGAAAAGAGAGAGAAGAAGG + Intronic
1036633837 8:10533963-10533985 AAGGGAAAAGAGAAAGGAGAAGG + Intronic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1036962921 8:13265670-13265692 AAGGAAGAAGAGAAGGAAGAAGG - Intronic
1037278844 8:17212647-17212669 AAGGGAAAATAGATTGGAGTGGG - Intronic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037327831 8:17711895-17711917 AAAGGGAGAGAGATGGAAGAGGG + Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038834146 8:31099930-31099952 AAGGTAATACACATGGCAGATGG + Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039138816 8:34359459-34359481 AATGGAAAACAGATCAAAGCAGG - Intergenic
1039205205 8:35145122-35145144 AAGGGAGAAGGAATGGAAGATGG - Intergenic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1039980945 8:42409663-42409685 AAAGTAAAACAAATGGAAAAGGG + Intergenic
1040690947 8:49937708-49937730 AAGGGAAACCAGAGGTAAAAAGG + Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041730619 8:61058723-61058745 AACAGAAAACAGATCAAAGAAGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042159054 8:65873771-65873793 AAGGCAAAACAGAGGAAAGCAGG - Intergenic
1042397825 8:68311905-68311927 AGGGAAAAAGAGAAGGAAGAAGG - Intronic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1042854264 8:73249840-73249862 AAAGGAAAGCTGAGGGAAGATGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043022749 8:75024648-75024670 TATGGAAAACAGATTGGAGAGGG + Intronic
1043148170 8:76681829-76681851 AAGGGGAAAGAGATAGAAAAGGG - Intronic
1043326062 8:79053044-79053066 AAGAGAAAAAAAATGGAAAAAGG - Intergenic
1043519026 8:81024847-81024869 AAGGTAGAAAAGATGGAAGAAGG - Intronic
1043674080 8:82927449-82927471 AAAGAAAAACAGAAGGAAGGAGG + Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044243843 8:89918083-89918105 AATGGAAAACCGGTGGCAGAAGG - Intronic
1044305991 8:90642072-90642094 AAAGGATAATATATGGAAGAAGG - Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045062976 8:98424580-98424602 AAAGAAAAACAGAAGGCAGAGGG + Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045433811 8:102139220-102139242 AAAACAAAACAGGTGGAAGAAGG - Intergenic
1045865231 8:106857745-106857767 AAGGCAAATGAGATAGAAGATGG - Intergenic
1045881846 8:107050306-107050328 AAGGGAAGAAGGATGGAAGATGG - Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046186610 8:110729735-110729757 AAGGGAGAAAAGAAGGAAAATGG + Intergenic
1046342956 8:112882532-112882554 AAGGGAAAAGAGTGGGAAGGAGG - Intronic
1046732053 8:117736479-117736501 AAGGGACAAAAGAGGGAAGATGG + Intergenic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1046906586 8:119580375-119580397 AAGGAAACAGAGATTGAAGAAGG - Intronic
1047031199 8:120883122-120883144 AAGGGAAAGCAGACTAAAGATGG + Intergenic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047217888 8:122893414-122893436 GAGGGAGAAGAGATGGAAAAAGG - Intronic
1047329973 8:123878108-123878130 AATTAAAAACAGCTGGAAGAAGG + Intronic
1047425657 8:124743097-124743119 AAGGGCATACAGATTGAAGGTGG + Intergenic
1047735072 8:127757929-127757951 AAGAGAAAACAGGTGCAAGTAGG + Intergenic
1047781090 8:128111705-128111727 AAGGAAAAAGAGAGGGCAGAGGG + Intergenic
1047930746 8:129726357-129726379 AAGGAGAAAGACATGGAAGAGGG + Intergenic
1048516537 8:135116621-135116643 AAAGGAAGAAAGATGGAAGATGG + Intergenic
1048551653 8:135438887-135438909 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551657 8:135438914-135438936 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1049066437 8:140320047-140320069 AAGGAAAAACCTAAGGAAGAAGG + Intronic
1049579266 8:143404022-143404044 AAGGAAAAACAAAGGGAACATGG + Intergenic
1050165017 9:2756401-2756423 AAGGGAAAAAAGAGGGGACAGGG + Intronic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050474494 9:6025899-6025921 AACCTAAAACAGACGGAAGACGG - Intergenic
1050685778 9:8167604-8167626 AAGGGAGAACAGTTGGCAAAGGG + Intergenic
1051035243 9:12736781-12736803 ACAGGAAAACAGATGTTAGATGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051570162 9:18547417-18547439 AATGGAAAATAAATGCAAGATGG + Intronic
1052187671 9:25619327-25619349 AAGGGAAACCAGATTTGAGAGGG - Intergenic
1052356686 9:27512104-27512126 AAAGGAAACCACATGGAAGATGG + Intronic
1052622585 9:30933299-30933321 TAGGGAAAACAAATAGAAAAGGG - Intergenic
1052767167 9:32652720-32652742 AATGGAAAACAGATAAAAGCAGG + Intergenic
1052837996 9:33265486-33265508 TGGGGATGACAGATGGAAGAAGG - Intronic
1053198479 9:36137184-36137206 AAGGAACAACAAATGGATGAGGG - Intronic
1053335940 9:37271367-37271389 AAGGGAAGAAATATGGAAGGGGG + Intronic
1053523617 9:38807091-38807113 AGGAGAAGACTGATGGAAGATGG - Intergenic
1054195847 9:62031508-62031530 AGGAGAAGACTGATGGAAGATGG - Intergenic
1054642561 9:67557182-67557204 AGGAGAAGACTGATGGAAGATGG + Intergenic
1054752551 9:68922606-68922628 AAGGGAAAGGAGGTGGATGAAGG - Intronic
1054851104 9:69847686-69847708 AAGGGGAAACAGATGGGAATAGG - Intronic
1055018549 9:71645078-71645100 AAGGAAAAAAAGAGGGAAGGAGG - Intergenic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055633493 9:78249276-78249298 AAGGGAAAAAAAATGGAACTGGG - Intronic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1056075877 9:83039708-83039730 AAGGGAAAAAATAGTGAAGAAGG - Intronic
1056300359 9:85233736-85233758 GAGGGAAAGGAGATGGGAGAAGG - Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1057562549 9:96139907-96139929 AAGGGAGAGCAGCTGGAAGAGGG - Intergenic
1058315211 9:103556303-103556325 AATGGAAAACAGATAAAAGTAGG + Intergenic
1058777321 9:108297111-108297133 TATGGAAACCAGATGGAAGCTGG - Intergenic
1058914854 9:109555838-109555860 AAGGGATAAAAGAAGGAAGGGGG + Intergenic
1058996731 9:110306303-110306325 AAGGTAAAACATATGGAATTTGG - Intronic
1059156070 9:111989331-111989353 AATTGAAAGCAGATAGAAGAGGG + Intergenic
1059226481 9:112677737-112677759 AGGGGAAAAAACATGGAAGGTGG + Intergenic
1059229825 9:112709377-112709399 ATGGGAAAACAGAATGAATAAGG + Intronic
1059354504 9:113688197-113688219 AAGAGGAAACAGATCGGAGAGGG - Intergenic
1059529823 9:115025618-115025640 AAGGTAAAACAGCTTGTAGAAGG - Intronic
1059648379 9:116290261-116290283 AACGAAAAGCAGATGGAATAAGG - Intronic
1060104945 9:120867851-120867873 AAGGAACCACAGATGTAAGAGGG - Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060575575 9:124689831-124689853 AAGGGAGAACAGAGAAAAGAGGG - Intronic
1060733469 9:126051909-126051931 AAGGGAAATCAGATGGGTGGGGG - Intergenic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1061244737 9:129395653-129395675 ATGGGAGAAAGGATGGAAGATGG + Intergenic
1061279459 9:129588900-129588922 AAGGGAAAAAAGGTGGATTAAGG + Intergenic
1061281937 9:129602583-129602605 AGGGAAAAACAGAGAGAAGAAGG + Intergenic
1185610977 X:1393365-1393387 AAAGGAAAAGAGAGGGAAGGAGG - Intergenic
1185700463 X:2227549-2227571 AAGGGAGAAAGGAGGGAAGAAGG + Intronic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1185954880 X:4478380-4478402 AAGGGAGGAAAGAGGGAAGAAGG + Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1187131321 X:16506037-16506059 AAGTGAAAAGACAAGGAAGAAGG + Intergenic
1187264472 X:17718628-17718650 AAGGAAAAAAGGAAGGAAGAAGG + Intronic
1187422855 X:19151337-19151359 AAGGGAGAAGAGATAGAGGAAGG - Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187736703 X:22312174-22312196 GAGGGAAGACAAATGGAAGAAGG + Intergenic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188015772 X:25106358-25106380 AAGGGATAAAAGATAGAAAAGGG + Intergenic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1188758167 X:33990033-33990055 GAGGGAAAGCAAATGGAAAACGG + Intergenic
1188922314 X:35992134-35992156 AAGGGAAAAGAGAAGAAACAGGG - Intergenic
1189042823 X:37560750-37560772 AAGGGGTAACAGATGGCACATGG + Intronic
1189206110 X:39240448-39240470 GAAGGAAGACAGAAGGAAGAGGG - Intergenic
1189215783 X:39321950-39321972 GAGGGAAAAAAAACGGAAGATGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189955067 X:46269507-46269529 AAGAGGAAGCATATGGAAGAAGG + Intergenic
1190124930 X:47695874-47695896 AAGTGAAATCAGAAGGCAGAAGG - Intergenic
1190203204 X:48381515-48381537 AAGGGAGAAGGGATGGGAGAAGG - Intergenic
1190207332 X:48413889-48413911 AAGGGAGAAGGGATGGGAGAAGG + Intergenic
1190363984 X:49674613-49674635 AAGGAAAAAGATATGCAAGAGGG - Intergenic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1191137862 X:57085035-57085057 AATGGAAAACAGAAAGAAGCAGG + Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191679775 X:63829232-63829254 AAGTAAAAACACATGGAAGTGGG - Intergenic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1192877313 X:75245285-75245307 AAAGGAAAACAGATAGATGCTGG + Intergenic
1193388746 X:80902091-80902113 AATGGAAAACAAATGAAAGCAGG + Intergenic
1193425273 X:81334976-81334998 AACGGAAAACAGAAAAAAGAAGG - Intergenic
1193435386 X:81469076-81469098 AAAGGAAAACAACTGGAAGATGG - Intergenic
1194215430 X:91124732-91124754 AAGGAAATACACCTGGAAGAGGG - Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194737614 X:97531242-97531264 AATGGAAAACGACTGGAAGAAGG - Intronic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1195286814 X:103393806-103393828 AAGGGAAAACTGAGGTAACAAGG + Intergenic
1195328500 X:103777287-103777309 AAGGGAAAAGAGAAGATAGAGGG - Intronic
1195443551 X:104923978-104924000 AATGGAAAACAAATGAGAGAAGG + Intronic
1195487091 X:105421608-105421630 AAGAGAAAATAGGGGGAAGAGGG + Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195574554 X:106435417-106435439 AAGGAAAGACAAATGTAAGATGG + Intergenic
1196068120 X:111488228-111488250 AAGGAAAGAAGGATGGAAGAAGG - Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196554717 X:117072837-117072859 AATGGAAAACAGATAAAAGCAGG + Intergenic
1196802906 X:119559526-119559548 AAGGAAAAACAGGTGGGAGTGGG - Intronic
1196871854 X:120120225-120120247 AAGGGAGAAAAGGTGGAAGGAGG + Intergenic
1196915649 X:120532501-120532523 AAGGGCAAAGACATTGAAGATGG - Exonic
1196974823 X:121147838-121147860 AAGGGAAAAAGGAAGGAAAAAGG + Intergenic
1197165986 X:123378301-123378323 AGGGGAAAATAGAGGAAAGAAGG - Intronic
1197715855 X:129705600-129705622 AAAGGATAAAAGATGGAAGCAGG - Intergenic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1198341481 X:135718722-135718744 AAAGTAAAACAGAAGAAAGATGG - Intronic
1198346517 X:135764641-135764663 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198348423 X:135781926-135781948 AAAGTAAAACAGAAGAAAGATGG + Intergenic
1198350327 X:135799190-135799212 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198352235 X:135816462-135816484 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198354143 X:135833730-135833752 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198356053 X:135850980-135851002 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198357966 X:135868258-135868280 AAAGTAAAACAGAAGAAAGATGG + Intergenic
1198359881 X:135885541-135885563 AAAGTAAAACAGAAGAAAGATGG + Intronic
1198366726 X:135947330-135947352 AAAGTAAAACAGAAGAAAGATGG + Intergenic
1198381227 X:136085315-136085337 AAGGGCTAACATATGGAAGAGGG - Intergenic
1198549982 X:137735186-137735208 CAGGGAGAACAGATGCATGAAGG - Intergenic
1198688755 X:139257335-139257357 AAGAGAAAATAGATTGAAAAAGG - Intergenic
1198692477 X:139299378-139299400 AAGGTAACACAGAGGTAAGAAGG + Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199365813 X:146981269-146981291 AAGGGAAAACAGAAAAAAGCAGG - Intergenic
1199445887 X:147920468-147920490 AAAGGAAAACATACTGAAGAAGG - Intronic
1199471797 X:148203963-148203985 AAAGGAAAAAAGAGAGAAGAGGG + Intergenic
1199474535 X:148231076-148231098 AGGGGAAGAGAGAGGGAAGAGGG - Intergenic
1200046466 X:153405496-153405518 AAGGGGAAACAAGTGCAAGAAGG - Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200526720 Y:4282132-4282154 AATGGAAAACAGAAAAAAGAAGG + Intergenic
1200868134 Y:8067424-8067446 TAGGGAAAACAGAATAAAGATGG + Intergenic
1200944157 Y:8815732-8815754 GAAGGAAAACTGATGGAACAGGG - Intergenic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic
1201171809 Y:11273882-11273904 AAGGGGTAACAGATGGAACCTGG - Intergenic
1201325258 Y:12749392-12749414 GAGGGAAAACAGTTGGCAGTGGG - Intronic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201470163 Y:14324481-14324503 AATGGAAGACAGAAGGCAGAAGG - Intergenic
1201517668 Y:14835446-14835468 AAGGAAAGAAAGAGGGAAGAGGG + Intronic
1201681471 Y:16649033-16649055 AATGGCAAACACATGGAACAGGG - Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic
1201933815 Y:19384587-19384609 AACGGAAAACAGAAGAAAGCGGG - Intergenic