ID: 1028570784

View in Genome Browser
Species Human (GRCh38)
Location 7:92284545-92284567
Sequence GTTCTTAAAAGAATAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028570780_1028570784 -5 Left 1028570780 7:92284527-92284549 CCAGTGTTTGACATCTCAGTTCT 0: 1
1: 0
2: 3
3: 20
4: 209
Right 1028570784 7:92284545-92284567 GTTCTTAAAAGAATAAAAGGGGG No data
1028570779_1028570784 27 Left 1028570779 7:92284495-92284517 CCTAAATCTTTATGGACTTAAAA 0: 1
1: 0
2: 1
3: 53
4: 565
Right 1028570784 7:92284545-92284567 GTTCTTAAAAGAATAAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028570784 Original CRISPR GTTCTTAAAAGAATAAAAGG GGG Intronic
No off target data available for this crispr