ID: 1028573996

View in Genome Browser
Species Human (GRCh38)
Location 7:92325556-92325578
Sequence GTTTAGATGTTCAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028573996_1028573999 13 Left 1028573996 7:92325556-92325578 CCTTTCTCCCTGAACATCTAAAC 0: 1
1: 0
2: 1
3: 25
4: 171
Right 1028573999 7:92325592-92325614 TTAACAGTTACAGTTACTTTTGG 0: 1
1: 0
2: 3
3: 18
4: 261
1028573996_1028574000 14 Left 1028573996 7:92325556-92325578 CCTTTCTCCCTGAACATCTAAAC 0: 1
1: 0
2: 1
3: 25
4: 171
Right 1028574000 7:92325593-92325615 TAACAGTTACAGTTACTTTTGGG 0: 1
1: 0
2: 2
3: 29
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028573996 Original CRISPR GTTTAGATGTTCAGGGAGAA AGG (reversed) Intronic
900850873 1:5142094-5142116 GTTTAGATGTCAGGGGAGTAGGG - Intergenic
902976843 1:20094688-20094710 GTTAAGGAGTTCAGGCAGAAAGG - Intergenic
915955788 1:160218963-160218985 GTTTACCTGGTCAGGAAGAAAGG + Exonic
918016723 1:180641397-180641419 GTTTAGGTTTTCATGGAAAATGG + Intronic
918297321 1:183169262-183169284 GTTTGGAGTTTGAGGGAGAAGGG + Intergenic
918557763 1:185824547-185824569 GGTTAGATTATCGGGGAGAATGG + Intronic
919144748 1:193620052-193620074 GTAAATTTGTTCAGGGAGAATGG - Intergenic
924561544 1:245160321-245160343 GTTGAGATTTTAAGTGAGAATGG + Intronic
1063259236 10:4366498-4366520 GTTTAGTTTTTTATGGAGAAGGG + Intergenic
1063984897 10:11491769-11491791 GTTCAGATTTTCAGGAAGAAAGG + Intronic
1064089784 10:12373673-12373695 TTTTAGATGTTCATAGGGAATGG - Intronic
1064106996 10:12508702-12508724 GTTTAGTTGGGGAGGGAGAAAGG - Intronic
1065404730 10:25351131-25351153 GTTTATATGTTTATAGAGAAGGG - Intronic
1065632170 10:27691312-27691334 GTTCCGATGTTGAGGGTGAAGGG + Intronic
1066526662 10:36287334-36287356 CTTTAAATGTTGGGGGAGAATGG - Intergenic
1067270953 10:44790895-44790917 GTTTAGATAAGGAGGGAGAAAGG - Intergenic
1068876741 10:62005117-62005139 GCTCTGATCTTCAGGGAGAAGGG + Intronic
1069832157 10:71287988-71288010 GGCTAGAGGGTCAGGGAGAAGGG - Intronic
1073364551 10:102927813-102927835 GCTTAGATGTTGATGGATAATGG + Intronic
1075173116 10:120134279-120134301 GTTTTGATGGTCAAGGAGCAGGG + Intergenic
1075899690 10:126030823-126030845 TTTTAGATTTACAGGGGGAATGG + Intronic
1076092842 10:127703241-127703263 GCTTAGATGTTCAGGGATAGAGG + Intergenic
1076230195 10:128814018-128814040 GTTAAGATGCTCAGGAAGCAGGG + Intergenic
1076342251 10:129757441-129757463 CGTTAGGTGTTCTGGGAGAACGG - Intronic
1077154081 11:1083793-1083815 CTCTCGATGTTCAGGGAGCAGGG - Intergenic
1078952947 11:16155907-16155929 ATTTGGATATTCAGGGAGAAGGG - Intronic
1080456379 11:32423248-32423270 GTCTGGATGGACAGGGAGAAAGG + Intronic
1080552280 11:33382892-33382914 ATTTGGGGGTTCAGGGAGAAGGG + Intergenic
1082895848 11:58189059-58189081 GATTGGAAGCTCAGGGAGAAAGG + Intergenic
1084233768 11:67772638-67772660 GTTTAGATGTTTGGGGTAAAGGG - Intergenic
1084900485 11:72306516-72306538 GTTTAACTTTTTAGGGAGAAAGG - Intronic
1087377183 11:97358523-97358545 TTTTAGATATTTAGGGAAAAAGG - Intergenic
1089403940 11:118181843-118181865 GTTTGGGGGTTCAGGGAGAGGGG + Intergenic
1090307191 11:125701817-125701839 TTTTAGATACTCAGGGAAAATGG + Intergenic
1093776930 12:23086512-23086534 GTTTAGATGCTCACTGAGAGAGG - Intergenic
1096399444 12:51293135-51293157 GTTTTGATGTTCAGTGAGTATGG + Intronic
1098209606 12:68149673-68149695 GTTGAGATGTTCAGGCTGCATGG - Intergenic
1098516792 12:71386788-71386810 GTTGAGATGTTTAGGGATATTGG + Intronic
1103853897 12:123951118-123951140 GTTCAGATGTGCAGGAAGAATGG - Intronic
1104688541 12:130806736-130806758 TTTTAGAGTTTCAGGGAGATTGG - Intronic
1107919991 13:45196461-45196483 GAATAGATTTTGAGGGAGAAGGG + Intronic
1108642874 13:52398823-52398845 GTTTAGATATTTGGGGAAAATGG + Intronic
1110548156 13:76780091-76780113 GATCAGAGGTTTAGGGAGAAAGG - Intergenic
1111372881 13:87339797-87339819 GTTGAGTTTGTCAGGGAGAAAGG + Intergenic
1111712833 13:91838753-91838775 GGTCAGAAGCTCAGGGAGAATGG + Intronic
1114294617 14:21317829-21317851 CTTGAGCTGTCCAGGGAGAAAGG + Exonic
1115549413 14:34491527-34491549 GTGTCCTTGTTCAGGGAGAAAGG - Intergenic
1116466853 14:45243872-45243894 GTTTATATTTTCTGGGGGAAAGG + Intronic
1116551621 14:46247146-46247168 GTTTCAAAGTTCAGGTAGAAAGG + Intergenic
1117162567 14:53003581-53003603 GTTTAGATGTCCTGGAAGTATGG + Intergenic
1120053417 14:79895023-79895045 TCTTAGATTATCAGGGAGAAAGG - Intergenic
1121634653 14:95445757-95445779 GCTGAGATGGTCAGGGACAAAGG + Intronic
1124690264 15:31815891-31815913 GGACAGATGTTCTGGGAGAAAGG + Intronic
1124987622 15:34637085-34637107 GATCAGAAGCTCAGGGAGAATGG + Intergenic
1126560450 15:50037256-50037278 GATTAGATGTTCCTTGAGAAAGG + Intronic
1127714380 15:61634622-61634644 ATTTTAATGTTCAGAGAGAATGG - Intergenic
1127742609 15:61927180-61927202 GTTTGGATGTTGACAGAGAAAGG + Exonic
1130813025 15:87402275-87402297 GATTGGATGTGTAGGGAGAAGGG + Intergenic
1131300326 15:91194058-91194080 GGTTCGATGGTCAGGGAGGAGGG + Intronic
1131986160 15:98044407-98044429 GGGTAGATGGGCAGGGAGAAGGG - Intergenic
1132787549 16:1666284-1666306 GCTTAGATGTTCTTGGTGAAGGG - Intronic
1144922137 17:18772842-18772864 GTTTAGTGGATCAGAGAGAATGG - Intronic
1147559593 17:41500669-41500691 ATTAGGATGTTCAGTGAGAATGG - Intergenic
1151036988 17:70811940-70811962 GATTAGGTGTTCAGAAAGAATGG - Intergenic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1155610329 18:27660063-27660085 GTTTTGATGTACAGTGAGAATGG - Intergenic
1156579105 18:38354828-38354850 GAGTAGTTGTTGAGGGAGAAGGG + Intergenic
1156620195 18:38842608-38842630 GTTTGGTTTTTCAGGGAGATCGG - Intergenic
1157152153 18:45228893-45228915 GTATAGATGTTAAAGGAGAGGGG - Intronic
1157398965 18:47370765-47370787 GTCTAAATTTTCAGGGTGAAGGG + Intergenic
1158741216 18:60144453-60144475 GGTGAGATGTTCAGGGAAAATGG - Intergenic
1162458868 19:10802607-10802629 GTTCAGATCTGCAGGGAGAGGGG + Intronic
1163842159 19:19618255-19618277 GTTTAGGGGTTTAGGGAGTAGGG - Intronic
1164586227 19:29477839-29477861 GTTTTGATGTTAAGGGAAAGGGG - Intergenic
1166295767 19:41888572-41888594 GGGCAGGTGTTCAGGGAGAATGG - Intronic
1166415454 19:42592097-42592119 CTTTGGATGCTCAGGAAGAAAGG + Intronic
1166444601 19:42847902-42847924 GTTTTGATGTCCAGGGATAAAGG + Intronic
1166452039 19:42910459-42910481 GCTTTGATGTTCAGGGATAAAGG + Intronic
928168290 2:28986744-28986766 GTTCAGATGTTCAGGAAGAGGGG - Intronic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
931256182 2:60575499-60575521 GTTTCGAGGTTCAGGCTGAAAGG - Intergenic
932890452 2:75591875-75591897 GTATATATTATCAGGGAGAAGGG + Intergenic
934953773 2:98599179-98599201 TTTTAGAGGCTGAGGGAGAAGGG + Intergenic
934974302 2:98789767-98789789 GCTTTGGTATTCAGGGAGAAGGG - Intergenic
935075829 2:99742922-99742944 ATTTAAATGTTCAGGGTAAAGGG - Intronic
939765225 2:146240013-146240035 GGTTAGACCTTCAGGGAGAAAGG - Intergenic
940023104 2:149176941-149176963 GTTTAGATGACCAGGGACATGGG - Intronic
940648665 2:156418538-156418560 ATTTGGCTGGTCAGGGAGAATGG - Intergenic
941766055 2:169297723-169297745 GTTTACATAATCAGGGAGGAGGG + Intronic
942929747 2:181475365-181475387 GTTTAGATGTTCAGAGGAGAGGG + Intronic
943024140 2:182608203-182608225 TTTTAGATTTTCAGGGAAAAGGG - Intergenic
943615318 2:190085624-190085646 GATAAGTTGTTCAGGGGGAAGGG - Intronic
945058551 2:205888680-205888702 GTTTGGGGGTTCAGTGAGAAGGG + Intergenic
945140315 2:206679388-206679410 GTCTAGATTGTCAAGGAGAAGGG - Intronic
945160441 2:206884871-206884893 TTTTAGATGTTCAAGTAGACTGG + Intergenic
946003169 2:216499818-216499840 GTTTTGTTTTTGAGGGAGAAAGG + Intronic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
947658806 2:231851286-231851308 GTTTAGTTAGTCAGGGAGATGGG - Intergenic
1170774430 20:19363330-19363352 GATTTGATGTCCTGGGAGAATGG - Intronic
1171476538 20:25413775-25413797 GTTTATATGTTCTAGGAGGATGG + Exonic
1172996897 20:39077503-39077525 GTTCAGATTTTCAGGGTTAACGG - Intergenic
1173443022 20:43094969-43094991 GATCAGGTGTTCAGGGGGAAAGG + Intronic
1180907655 22:19426166-19426188 GGTGAGATGCTCAGGGAGACAGG - Intronic
1181150203 22:20877843-20877865 GTTGAGATGTGCAGGCTGAAAGG + Intronic
1184684494 22:46090006-46090028 ATTTAGATATTCGGGGAGACTGG + Intronic
949860116 3:8497722-8497744 GTGTAGTGGGTCAGGGAGAATGG - Intergenic
951252109 3:20405796-20405818 ATTTAAACCTTCAGGGAGAATGG + Intergenic
951619510 3:24585798-24585820 TTTTGGATGCTCAGGGATAATGG - Intergenic
951643752 3:24864807-24864829 CTTTTGATGTTCTGGGATAAAGG - Intergenic
952538667 3:34342582-34342604 TTTTAGATGTACAGTGAAAAAGG - Intergenic
953552241 3:43912536-43912558 GCTTAGATGTCCAGAGAGGAAGG - Intergenic
958755760 3:98247764-98247786 GTTTGGAGGTGCAGGGAGACAGG - Intergenic
960612665 3:119569376-119569398 GTTTAGATGGGCAGAGAGAATGG - Intergenic
969821381 4:9723118-9723140 GTTTAGATGTTTGGGGTAAAGGG + Intergenic
970031349 4:11678679-11678701 GTCTGGATGTTCACTGAGAATGG + Intergenic
970782462 4:19754765-19754787 GTCTCGATGTGCAGGGATAATGG - Intergenic
970819594 4:20197109-20197131 GTTTGGAGGTGCAGGTAGAAAGG - Intergenic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
971966493 4:33563732-33563754 GCTTAGATGTTAAGAGTGAAAGG - Intergenic
972722328 4:41712720-41712742 CTATAGATATTCTGGGAGAAAGG - Intergenic
973099229 4:46241905-46241927 GTTTAGAAGATCAGGGATATGGG - Intergenic
974213525 4:58814272-58814294 GATTAGATTTTTAGGGACAAAGG + Intergenic
974524836 4:63036395-63036417 TTTTAAACGTTCAGGGAGATTGG - Intergenic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
977611757 4:99042309-99042331 ATTTAGATTTTCAGTAAGAATGG + Intronic
978789825 4:112650182-112650204 GTTCCTTTGTTCAGGGAGAAGGG + Intronic
979270642 4:118756639-118756661 TTGTTGATGTTCAGGGAGACAGG + Intronic
979993472 4:127403597-127403619 GTTTTGATGTTCTGGGAGACTGG - Intergenic
979993959 4:127408734-127408756 GTTTAGATGTGCAGGCACAGTGG - Intergenic
981650721 4:147055026-147055048 GCTTGGATGTTCAGAGAGAAAGG - Intergenic
984621516 4:181958174-181958196 GTGTCTATGTTCAGGAAGAAAGG - Intergenic
986038473 5:3963249-3963271 CTTTGGATTTTGAGGGAGAAGGG + Intergenic
987559581 5:19502065-19502087 TTAAAGATGTTCAGGGAAAATGG + Intronic
988546026 5:32158236-32158258 CTTTAGAGGTTTGGGGAGAATGG - Intronic
989077737 5:37582496-37582518 TTTTAGATGTTAAAGTAGAAGGG + Intronic
990773391 5:59276935-59276957 GTGTAGATGTTCAGAGAGATAGG - Intronic
991665513 5:68995772-68995794 TTTTAGAGGTTCATGGAAAAAGG - Intergenic
992753811 5:79885805-79885827 GTTTAAGAGTTCAGGGTGAAGGG - Intergenic
996494436 5:124137719-124137741 TTTAATATGTTCAGGGAAAAGGG - Intergenic
997791116 5:136763229-136763251 GTTTAGAAGGTCTCGGAGAAAGG - Intergenic
1000917852 5:167103680-167103702 GGTTAGATTCACAGGGAGAATGG - Intergenic
1001098365 5:168794004-168794026 GTTTGGATTTCCAGGGAGATGGG + Intronic
1001554852 5:172630170-172630192 GTTTTAATGTTAAGTGAGAAAGG - Intergenic
1002819338 6:710522-710544 GTTTACTTCTTCAGGGAAAAGGG - Intergenic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1006713861 6:36101015-36101037 ATTTACATGTTCAAGTAGAAAGG + Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1013281770 6:108644512-108644534 GTTTAGTGCTTCAAGGAGAAAGG - Intronic
1013400109 6:109785876-109785898 GTTTAGTTGTTCTGGGAGAAAGG + Intronic
1015067969 6:129053907-129053929 GTTTAGATGCTTGGGGGGAAAGG + Intronic
1015413236 6:132918268-132918290 GTTTGGAAGTTCTGGGGGAAAGG + Intergenic
1017331538 6:153204434-153204456 GTGTAGATGTGGAGTGAGAAAGG + Intergenic
1017983551 6:159423099-159423121 GTTTGGATGTGCAAAGAGAAAGG - Intergenic
1018200958 6:161395308-161395330 GTGTGGCTGTTCAGGAAGAATGG - Intronic
1019920157 7:4158172-4158194 GTTGAAATCCTCAGGGAGAAAGG - Intronic
1022079416 7:27004869-27004891 GTATCGATGTTCAGGGATATTGG + Intergenic
1023173807 7:37416381-37416403 GTTTAATTATTCAGTGAGAATGG - Intronic
1027738777 7:81972677-81972699 GTTTAGAGGAACAAGGAGAATGG - Intronic
1028573996 7:92325556-92325578 GTTTAGATGTTCAGGGAGAAAGG - Intronic
1037328313 8:17717375-17717397 TTTTAGATGTTCATAGAAAATGG + Intronic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1037924300 8:22832534-22832556 CCTAAGATGTTCAGGGAGAGGGG + Intronic
1039062510 8:33582878-33582900 GTCTAGATTTCCATGGAGAAAGG + Intergenic
1039574385 8:38611709-38611731 GTTTAGGTGTTCAGGGATCCAGG + Intergenic
1039597871 8:38807118-38807140 GCTTAGATGTGCATGGAGAATGG - Intronic
1039772319 8:40699904-40699926 AGTTAGAGCTTCAGGGAGAAAGG - Intronic
1041018575 8:53615727-53615749 GTTTCCATCTTCAGGGAGAGTGG - Intergenic
1041115032 8:54527116-54527138 GATTAGATCTGCAGGGGGAAGGG + Intergenic
1044257591 8:90083192-90083214 GTTTAAATGTTCAGATAGAAGGG + Intronic
1045499836 8:102736722-102736744 TTTTAGTTGGTCAGGGAGATGGG + Intergenic
1046447287 8:114339423-114339445 GATTAAATGTCGAGGGAGAATGG + Intergenic
1047372160 8:124265111-124265133 GTTTGGATGTTCAGGGCAATGGG - Intergenic
1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG + Intergenic
1047864810 8:129011122-129011144 GTTTAGAAATTAAGGGAAAAAGG + Intergenic
1048677689 8:136802089-136802111 CTTTACATCTTCTGGGAGAATGG + Intergenic
1049855751 8:144860788-144860810 GTTTAGATGTTAAGAGGCAAAGG + Intergenic
1051059097 9:13025604-13025626 GGTTACATTTTCAGTGAGAAAGG + Intergenic
1051788426 9:20772129-20772151 GATTAGATGGTCAAGGAGAAGGG + Intronic
1055059047 9:72049921-72049943 TTTTAGTGGGTCAGGGAGAAGGG + Intergenic
1055808579 9:80124894-80124916 GTTGAGTTGTGCAAGGAGAAAGG - Intergenic
1055978249 9:81975280-81975302 GCTTAGACGTTCAGGAAGAATGG + Intergenic
1056458623 9:86787911-86787933 GTTTTGATGTTGGGGGAGAGGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059523079 9:114962234-114962256 GTATAGATGTGTAGGGAGTATGG + Intergenic
1060715362 9:125922228-125922250 GTTTGGATTTTTAAGGAGAAAGG + Intronic
1061108192 9:128548679-128548701 GGTAAGATTTTCAGGCAGAAAGG + Intergenic
1188916178 X:35913838-35913860 CTTTGGAGATTCAGGGAGAAGGG - Intergenic
1188936470 X:36182303-36182325 ATTTAGATGTGTATGGAGAAAGG - Intergenic
1189200608 X:39192817-39192839 TTTTAGATGTTAGGGGTGAAAGG + Intergenic
1189544605 X:42028493-42028515 GTTTATATGTCCAAGGACAACGG + Intergenic
1192589042 X:72344727-72344749 TTATAGAGGATCAGGGAGAAAGG - Intronic
1192763902 X:74123619-74123641 GTTTGGAGGTGCAGGGAGACAGG + Intergenic
1194584710 X:95718136-95718158 ATTTACATTTTCAGGGAGAGGGG + Intergenic
1195251850 X:103055771-103055793 GTTTAAATGTTAAGTGAAAAAGG + Intergenic
1195862998 X:109400956-109400978 TTTTAAATGTGCAGGGAGAAAGG - Intronic
1198382127 X:136093873-136093895 GTTTAGAGGTTAAAGGAAAATGG - Intergenic
1198561441 X:137854901-137854923 GTTTTGATCATGAGGGAGAATGG - Intergenic
1198626795 X:138584617-138584639 GTGATGCTGTTCAGGGAGAAGGG - Intergenic